Rorug02G0462700

acyl-CoA hydrolase activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
OG0004837
Physical Location & Seq
Reverse (-)
59398593 .. 59398916
324 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0462700.1

Sequence Viewer

Length: 324 bp
ATGTCTATGAACAAAATTCTAGTAGTGCCAGCACCACCTCCCCTCTTTAACATTCCAGGCCTATTGCCGCCAGGGTTCCCCGGCCTACTGCCGCCAACAAACCCAAATGACATAGCAAAGTGTTGGTCTTCACTTCAGAACATTCAAGGGTGTGTATCGGAAATCTTTACCTCAATCTCTACTCACAAAATAGAAGTAGGCCCTGCCTGTTGTAAAGCTTTCCTTGCAATTGAAGAGAGTTGCTGGCCGAAAATGTTCCCCTTAACTCCTTTCTTTGCTCCATTGCTCAAGAACACTTGTGCTCAGAAGGCAGCTCTTGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
4HBT

Protein Analysis

107

Amino Acids

11.52

Weight (kDa)

8.26

Isoelectric Point (pI)

83.17

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Prolamin_like PF05617 40 - 100 5.5e-17 Prolamin-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 68, 92
AcoI YGGCCR 1 cut(s) 245
AcsI RAATTY 1 cut(s) 15
AcuI CTGAAG 1 cut(s) 119
AgsI TTSAA 2 cut(s) 146, 233
AjnI CCWGG 2 cut(s) 55, 70
AluBI AGCT 2 cut(s) 218, 314
AluI AGCT 2 cut(s) 218, 314
Alw21I GWGCWC 1 cut(s) 304
AoxI GGCC 4 cut(s) 58, 82, 199, 245
ApeKI GCWGC 1 cut(s) 311
ApoI RAATTY 1 cut(s) 15
ArsI GACNNNNNNTTYG 2 cut(s) 110, 142
Asp700I GAANNNNTTC 1 cut(s) 254
AspS9I GGNCC 1 cut(s) 200
AsuC2I CCSGG 1 cut(s) 81
BbsI GAAGAC 1 cut(s) 120
Bbv12I GWGCWC 1 cut(s) 304
BciT130I CCWGG 2 cut(s) 57, 72
BcnI CCSGG 1 cut(s) 81
BfaI CTAG 1 cut(s) 20
BisI GCNGC 3 cut(s) 68, 92, 312
BlsI GCNGC 3 cut(s) 69, 93, 313
Bme1390I CCNGG 3 cut(s) 57, 72, 81
BmgT120I GGNCC 1 cut(s) 200
BmiI GGNNCC 1 cut(s) 77
BmrFI CCNGG 3 cut(s) 57, 72, 81
BpiI GAAGAC 1 cut(s) 120
BpuEI CTTGAG 1 cut(s) 272
BpuMI CCSGG 1 cut(s) 81
BsaJI CCNNGG 2 cut(s) 71, 79
Bse3DI GCAATG 1 cut(s) 281
BseBI CCWGG 2 cut(s) 57, 72
BseDI CCNNGG 2 cut(s) 71, 79
BseMI GCAATG 1 cut(s) 281
BseMII CTCAG 1 cut(s) 317
BshFI GGCC 4 cut(s) 60, 84, 201, 247
BsiHKAI GWGCWC 1 cut(s) 304
BsiSI CCGG 1 cut(s) 81
BsnI GGCC 4 cut(s) 60, 84, 201, 247
Bsp1286I GDGCHC 1 cut(s) 304
BspACI CCGC 2 cut(s) 68, 92
BspANI GGCC 4 cut(s) 60, 84, 201, 247
BspCNI CTCAG 1 cut(s) 316
BspLI GGNNCC 1 cut(s) 77
BsrDI GCAATG 1 cut(s) 281
BssECI CCNNGG 2 cut(s) 71, 79
Bst2UI CCWGG 2 cut(s) 57, 72
Bst6I CTCTTC 1 cut(s) 228
BstC8I GCNNGC 2 cut(s) 30, 245
BstDEI CTNAG 1 cut(s) 303
BstMWI GCNNNNNNNGC 2 cut(s) 224, 308
BstNI CCWGG 2 cut(s) 57, 72
BstSCI CCNGG 3 cut(s) 55, 70, 79
BstV2I GAAGAC 1 cut(s) 120
BsuRI GGCC 4 cut(s) 60, 84, 201, 247
Cac8I GCNNGC 2 cut(s) 30, 245
Cfr13I GGNCC 1 cut(s) 200
CviJI RGCY 6 cut(s) 60, 84, 201, 218, 247, 314
CviKI_1 RGCY 6 cut(s) 60, 84, 201, 218, 247, 314
DdeI CTNAG 1 cut(s) 303
EaeI YGGCCR 1 cut(s) 245
Eam1104I CTCTTC 1 cut(s) 228
EarI CTCTTC 1 cut(s) 228
Eco147I AGGCCT 1 cut(s) 60
Eco57I CTGAAG 1 cut(s) 119
EcoO109I RGGNCCY 1 cut(s) 200
EcoRII CCWGG 2 cut(s) 55, 70
FaiI YATR 2 cut(s) 8, 113
FalI AAGNNNNNCTT 2 cut(s) 207, 239
Fnu4HI GCNGC 3 cut(s) 68, 92, 312
Fsp4HI GCNGC 3 cut(s) 68, 92, 312
FspBI CTAG 1 cut(s) 20
GluI GCNGC 3 cut(s) 68, 92, 312
HaeIII GGCC 4 cut(s) 60, 84, 201, 247
HapII CCGG 1 cut(s) 81
HindIII AAGCTT 1 cut(s) 216
HpaII CCGG 1 cut(s) 81
Hpy188I TCNGA 3 cut(s) 138, 160, 306
Hpy188III TCNNGA 1 cut(s) 289
HpyAV CCTTC 1 cut(s) 301
HpyCH4V TGCA 1 cut(s) 227
HpyF10VI GCNNNNNNNGC 2 cut(s) 224, 308
HpyF3I CTNAG 1 cut(s) 303
LmnI GCTCC 1 cut(s) 283
LpnPI CCDG 9 cut(s) 42, 42, 57, 69, 84, 94, 216, 220, 229
MaeI CTAG 1 cut(s) 20
MboII GAAGA 2 cut(s) 120, 245
MfeI CAATTG 1 cut(s) 228
MhlI GDGCHC 1 cut(s) 304
MluCI AATT 2 cut(s) 15, 228
MnlI CCTC 3 cut(s) 48, 53, 181
MroXI GAANNNNTTC 1 cut(s) 254
MseI TTAA 3 cut(s) 48, 263, 322
MspI CCGG 1 cut(s) 81
MspR9I CCNGG 3 cut(s) 57, 72, 81
MunI CAATTG 1 cut(s) 228
MvaI CCWGG 2 cut(s) 57, 72
MwoI GCNNNNNNNGC 2 cut(s) 224, 308
NciI CCSGG 1 cut(s) 81
NlaIV GGNNCC 1 cut(s) 77
PceI AGGCCT 1 cut(s) 60
PdmI GAANNNNTTC 1 cut(s) 254
PkrI GCNGC 3 cut(s) 69, 93, 313
Psp6I CCWGG 2 cut(s) 55, 70
PspGI CCWGG 2 cut(s) 55, 70
PspN4I GGNNCC 1 cut(s) 77
PspPI GGNCC 1 cut(s) 200
SaqAI TTAA 3 cut(s) 48, 263, 322
SatI GCNGC 3 cut(s) 68, 92, 312
Sau96I GGNCC 1 cut(s) 200
ScrFI CCNGG 3 cut(s) 57, 72, 81
SduI GDGCHC 1 cut(s) 304
SetI ASST 4 cut(s) 40, 173, 220, 316
SmlI CTYRAG 1 cut(s) 287
SmoI CTYRAG 1 cut(s) 287
Sse9I AATT 2 cut(s) 15, 228
SseBI AGGCCT 1 cut(s) 60
SsiI CCGC 2 cut(s) 68, 92
SspMI CTAG 1 cut(s) 20
StuI AGGCCT 1 cut(s) 60
StyD4I CCNGG 3 cut(s) 55, 70, 79
TasI AATT 2 cut(s) 15, 228
TauI GCSGC 2 cut(s) 70, 94
Tru1I TTAA 3 cut(s) 48, 263, 322
Tru9I TTAA 3 cut(s) 48, 263, 322
TseI GCWGC 1 cut(s) 311
TspDTI ATGAA 1 cut(s) 23
XapI RAATTY 1 cut(s) 15
XmnI GAANNNNTTC 1 cut(s) 254
XspI CTAG 1 cut(s) 20
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.