Rorug02G0624200

ASCH domain

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Reverse (-)
73996359 .. 73996848
490 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0624200.1

Sequence Viewer

Length: 420 bp
ATGTCTCAACCCTCTCAAGTTTTGCCTGCCAATGGTGGCAAATTTGTAGCTAGGGAGACCCAGGATGAAAGTAGCACAAGGCCAATTAATGTTGATGGGATTGATCAGGGACTGCTAGGGAGACCCGGCCATGATGAAAGTAGCACAAGGCCAATTAATGTTGATGGGATTGATCAGGGACTGGTTGACAAGATGGTGAAGACCATGTCTCAACCCTCTCAAGTTTTGCCTGCCAATGGTGGCAAATTTGTAGCTAGGGAGACCCAGGATGAAAGTAGCACAAGGCCAATTAATGTTGATGGGATTGATCAGGGACTGGTTGACAAGATGGTGTATGATGCTCTTATTTGGAGCTCAATTCATGGCCTTGTTGTTGGTGACAGGTCTCTGTTCAGAGGTCATCAACAATACCTGGAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

139

Amino Acids

15.1

Weight (kDa)

4.95

Isoelectric Point (pI)

46.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 127
AcsI RAATTY 2 cut(s) 41, 245
AfiI CCNNNNNNNGG 2 cut(s) 32, 236
AjnI CCWGG 3 cut(s) 60, 264, 411
AluBI AGCT 3 cut(s) 50, 254, 354
AluI AGCT 3 cut(s) 50, 254, 354
Alw21I GWGCWC 1 cut(s) 356
Alw26I GTCTC 6 cut(s) 9, 50, 115, 213, 254, 390
AlwNI CAGNNNCTG 3 cut(s) 112, 181, 316
AoxI GGCC 5 cut(s) 80, 127, 149, 284, 364
ApoI RAATTY 2 cut(s) 41, 245
AseI ATTAAT 3 cut(s) 87, 156, 291
AsuC2I CCSGG 1 cut(s) 126
AsuHPI GGTGA 2 cut(s) 208, 389
BanII GRGCYC 1 cut(s) 356
BbsI GAAGAC 1 cut(s) 206
Bbv12I GWGCWC 1 cut(s) 356
BccI CCATC 5 cut(s) 89, 158, 187, 293, 322
BciT130I CCWGG 3 cut(s) 62, 266, 413
BclI TGATCA 3 cut(s) 103, 172, 307
BcnI CCSGG 1 cut(s) 126
BcoDI GTCTC 6 cut(s) 9, 50, 115, 213, 254, 390
BfaI CTAG 3 cut(s) 51, 116, 255
Bme1390I CCNGG 4 cut(s) 62, 126, 266, 413
BmrFI CCNGG 4 cut(s) 62, 126, 266, 413
BmsI GCATC 1 cut(s) 328
BpiI GAAGAC 1 cut(s) 206
BpuEI CTTGAG 1 cut(s) 204
BpuMI CCSGG 1 cut(s) 126
BsaI GGTCTC 4 cut(s) 50, 115, 254, 390
BsaJI CCNNGG 2 cut(s) 60, 264
Bsc4I CCNNNNNNNGG 2 cut(s) 32, 236
Bse1I ACTGG 2 cut(s) 186, 321
BseBI CCWGG 3 cut(s) 62, 266, 413
BseDI CCNNGG 2 cut(s) 60, 264
BseGI GGATG 2 cut(s) 70, 274
BseLI CCNNNNNNNGG 2 cut(s) 32, 236
BseNI ACTGG 2 cut(s) 186, 321
BshFI GGCC 5 cut(s) 82, 129, 151, 286, 366
BsiHKAI GWGCWC 1 cut(s) 356
BsiSI CCGG 1 cut(s) 126
BslFI GGGAC 3 cut(s) 123, 192, 327
BslI CCNNNNNNNGG 2 cut(s) 32, 236
BsmAI GTCTC 6 cut(s) 9, 50, 115, 213, 254, 390
BsmFI GGGAC 3 cut(s) 123, 192, 327
BsnI GGCC 5 cut(s) 82, 129, 151, 286, 366
Bso31I GGTCTC 4 cut(s) 50, 115, 254, 390
Bsp1286I GDGCHC 1 cut(s) 356
Bsp143I GATC 3 cut(s) 103, 172, 307
BspANI GGCC 5 cut(s) 82, 129, 151, 286, 366
BspTNI GGTCTC 4 cut(s) 50, 115, 254, 390
BsrI ACTGG 2 cut(s) 186, 321
BssECI CCNNGG 2 cut(s) 60, 264
BssMI GATC 3 cut(s) 103, 172, 307
Bst2UI CCWGG 3 cut(s) 62, 266, 413
BstC8I GCNNGC 2 cut(s) 27, 231
BstF5I GGATG 2 cut(s) 70, 274
BstKTI GATC 3 cut(s) 106, 175, 310
BstMAI GTCTC 6 cut(s) 9, 50, 115, 213, 254, 390
BstMBI GATC 3 cut(s) 103, 172, 307
BstNI CCWGG 3 cut(s) 62, 266, 413
BstSCI CCNGG 4 cut(s) 60, 124, 264, 411
BstV2I GAAGAC 1 cut(s) 206
BsuRI GGCC 5 cut(s) 82, 129, 151, 286, 366
BtsCI GGATG 2 cut(s) 70, 274
Cac8I GCNNGC 2 cut(s) 27, 231
CaiI CAGNNNCTG 3 cut(s) 112, 181, 316
CviAII CATG 3 cut(s) 131, 205, 362
CviJI RGCY 8 cut(s) 50, 82, 129, 151, 254, 286, 354, 366
CviKI_1 RGCY 8 cut(s) 50, 82, 129, 151, 254, 286, 354, 366
DpnI GATC 3 cut(s) 105, 174, 309
DpnII GATC 3 cut(s) 103, 172, 307
EaeI YGGCCR 1 cut(s) 127
Ecl136II GAGCTC 1 cut(s) 354
Eco24I GRGCYC 1 cut(s) 356
Eco31I GGTCTC 4 cut(s) 50, 115, 254, 390
Eco53kI GAGCTC 1 cut(s) 354
EcoICRI GAGCTC 1 cut(s) 354
EcoRII CCWGG 3 cut(s) 60, 264, 411
EcoT38I GRGCYC 1 cut(s) 356
FaeI CATG 3 cut(s) 134, 208, 365
FaiI YATR 4 cut(s) 132, 206, 336, 363
FaqI GGGAC 3 cut(s) 123, 192, 327
FatI CATG 3 cut(s) 130, 204, 361
FbaI TGATCA 3 cut(s) 103, 172, 307
FokI GGATG 2 cut(s) 77, 281
FriOI GRGCYC 1 cut(s) 356
FspBI CTAG 3 cut(s) 51, 116, 255
HaeIII GGCC 5 cut(s) 82, 129, 151, 286, 366
HapII CCGG 1 cut(s) 126
Hin1II CATG 3 cut(s) 134, 208, 365
HincII GTYRAC 2 cut(s) 187, 322
HindII GTYRAC 2 cut(s) 187, 322
HpaII CCGG 1 cut(s) 126
HphI GGTGA 2 cut(s) 208, 389
Hpy166II GTNNAC 2 cut(s) 187, 322
Hpy188I TCNGA 1 cut(s) 395
Hpy8I GTNNAC 2 cut(s) 187, 322
Hsp92II CATG 3 cut(s) 134, 208, 365
Ksp22I TGATCA 3 cut(s) 103, 172, 307
Kzo9I GATC 3 cut(s) 103, 172, 307
LmnI GCTCC 1 cut(s) 351
LweI GCATC 1 cut(s) 328
MaeI CTAG 3 cut(s) 51, 116, 255
MaeIII GTNAC 1 cut(s) 377
MalI GATC 3 cut(s) 105, 174, 309
MboI GATC 3 cut(s) 103, 172, 307
MboII GAAGA 1 cut(s) 211
MhlI GDGCHC 1 cut(s) 356
MluCI AATT 6 cut(s) 41, 84, 153, 245, 288, 357
MnlI CCTC 3 cut(s) 22, 226, 389
MseI TTAA 3 cut(s) 87, 156, 291
MspI CCGG 1 cut(s) 126
MspR9I CCNGG 4 cut(s) 62, 126, 266, 413
MvaI CCWGG 3 cut(s) 62, 266, 413
NciI CCSGG 1 cut(s) 126
NdeII GATC 3 cut(s) 103, 172, 307
NlaIII CATG 3 cut(s) 134, 208, 365
NmuCI GTSAC 1 cut(s) 377
PflFI GACNNNGTC 1 cut(s) 205
PshBI ATTAAT 3 cut(s) 87, 156, 291
Psp124BI GAGCTC 1 cut(s) 356
Psp6I CCWGG 3 cut(s) 60, 264, 411
PspGI CCWGG 3 cut(s) 60, 264, 411
PstNI CAGNNNCTG 3 cut(s) 112, 181, 316
PsyI GACNNNGTC 1 cut(s) 205
SacI GAGCTC 1 cut(s) 356
SaqAI TTAA 3 cut(s) 87, 156, 291
Sau3AI GATC 3 cut(s) 103, 172, 307
ScrFI CCNGG 4 cut(s) 62, 126, 266, 413
SduI GDGCHC 1 cut(s) 356
SetI ASST 6 cut(s) 52, 256, 356, 386, 400, 414
SfaNI GCATC 1 cut(s) 328
SmlI CTYRAG 2 cut(s) 15, 219
SmoI CTYRAG 2 cut(s) 15, 219
Sse9I AATT 6 cut(s) 41, 84, 153, 245, 288, 357
SspMI CTAG 3 cut(s) 51, 116, 255
SstI GAGCTC 1 cut(s) 356
StyD4I CCNGG 4 cut(s) 60, 124, 264, 411
TasI AATT 6 cut(s) 41, 84, 153, 245, 288, 357
Tru1I TTAA 3 cut(s) 87, 156, 291
Tru9I TTAA 3 cut(s) 87, 156, 291
TseFI GTSAC 1 cut(s) 377
Tsp45I GTSAC 1 cut(s) 377
TspDTI ATGAA 4 cut(s) 81, 150, 285, 350
Tth111I GACNNNGTC 1 cut(s) 205
VspI ATTAAT 3 cut(s) 87, 156, 291
XapI RAATTY 2 cut(s) 41, 245
XspI CTAG 3 cut(s) 51, 116, 255
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.