Rorug04G0425700

Nuclear pore complex protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
OG0001803
Physical Location & Seq
Reverse (-)
58499548 .. 58501747
2200 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0425700.1

Sequence Viewer

Length: 738 bp
ATGGCTACCAGACTTAAATTCGAGAACTCGTGCGAGGTTGGGGTGTTCTCGAAGCTGACGAACGCTTACTGTTTGGTCTCGATCGGAGGCTCCGAGAGCTTTTACAGCACATTTGAGGCGGAGCTGGCTGACGTCATCCCTGTCGTCAAAACCTCCATCGGAGGCAGTCGCATCATTGGTCGTCTCTGTGCTGGGAACAAAAATGGGCTGCTTTTGCCTCACACCACCACTGATCAAGAGCTGCAGCACTTGAGGAACAGCTTGCCTGATCAAGTTGTTGTTCAGCGAGTCGACGAGAAGCTATCTGCACTTGGCAACTGTATTGCGTGCAATGATCATGTTGCTCTTACACATACTGATCTTGACAGGGAAACTGAGGAGATGATTGCAGATGTTCTTGGACTGGAAGTCTTTAGGCAGACAATTGCTGGTAATATTCTTGTGGGCAGTTACTGTGCTATCTCCAACAAAGGTGGCTTGGTTCATCCGCATACATCCGTGGAAGACTTGGATGAACTTTCAACACTTCTTCAGGTTCCTCTTGTAGCTGGTACAGTAAACCGTGGTAGTGAAGTGATAGCTGCTGGCATGACAGTGAATGACTGGACAGCGTTCTGTGGCTCAGACACCACAGCCACAGAAGTCTCGGTTATTGAAAATGTTTTCAAGTTGAGAGAGGCCCAACCTAGCGCCATTGTGGATGAAATGAGGAAATCGTTGATCGACAGCTATGTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03013 map03013
Pfam Domains
Protein Families
Nup192

Protein Analysis

245

Amino Acids

26.4

Weight (kDa)

4.75

Isoelectric Point (pI)

30.13

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
eIF-6 PF01912 4 - 203 2.3e-80 eIF-6 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 135
AccI GTMKAC 1 cut(s) 291
AciI CCGC 2 cut(s) 119, 488
AcsI RAATTY 1 cut(s) 17
AcuI CTGAAG 1 cut(s) 515
AcyI GRCGYC 1 cut(s) 132
AfaI GTAC 1 cut(s) 553
AgsI TTSAA 3 cut(s) 522, 656, 667
AhdI GACNNNNNGTC 1 cut(s) 407
AluBI AGCT 9 cut(s) 55, 99, 124, 241, 261, 301, 548, 581, 729
AluI AGCT 9 cut(s) 55, 99, 124, 241, 261, 301, 548, 581, 729
Alw26I GTCTC 3 cut(s) 82, 188, 649
AlwNI CAGNNNCTG 1 cut(s) 453
AoxI GGCC 1 cut(s) 678
ApeKI GCWGC 4 cut(s) 208, 241, 244, 581
ApoI RAATTY 1 cut(s) 17
AspLEI GCGC 1 cut(s) 692
AspS9I GGNCC 1 cut(s) 679
BauI CACGAG 1 cut(s) 28
BbsI GAAGAC 1 cut(s) 510
BbvI GCAGC 4 cut(s) 195, 228, 256, 568
BccI CCATC 1 cut(s) 164
BclI TGATCA 3 cut(s) 232, 268, 334
BcoDI GTCTC 3 cut(s) 82, 188, 649
BfaI CTAG 1 cut(s) 687
BfmI CTRYAG 1 cut(s) 242
BfoI RGCGCY 1 cut(s) 693
BisI GCNGC 4 cut(s) 209, 242, 245, 582
BlsI GCNGC 4 cut(s) 210, 243, 246, 583
BmeRI GACNNNNNGTC 1 cut(s) 407
BmgT120I GGNCC 1 cut(s) 679
BmiI GGNNCC 2 cut(s) 91, 537
BmsI GCATC 1 cut(s) 180
BpiI GAAGAC 1 cut(s) 510
BpuEI CTTGAG 1 cut(s) 271
BsaHI GRCGYC 1 cut(s) 132
BsaI GGTCTC 1 cut(s) 82
BsaJI CCNNGG 2 cut(s) 498, 562
Bse1I ACTGG 2 cut(s) 408, 608
Bse3DI GCAATG 1 cut(s) 337
BseDI CCNNGG 2 cut(s) 498, 562
BseGI GGATG 5 cut(s) 135, 484, 494, 517, 706
BseMI GCAATG 1 cut(s) 337
BseMII CTCAG 2 cut(s) 366, 636
BseNI ACTGG 2 cut(s) 408, 608
BseRI GAGGAG 1 cut(s) 392
BseXI GCAGC 4 cut(s) 195, 228, 256, 568
BseYI CCCAGC 1 cut(s) 191
BsgI GTGCAG 1 cut(s) 291
Bsh1285I CGRYCG 1 cut(s) 84
BshFI GGCC 1 cut(s) 680
BsiEI CGRYCG 1 cut(s) 84
BsmAI GTCTC 3 cut(s) 82, 188, 649
BsmBI CGTCTC 1 cut(s) 188
BsnI GGCC 1 cut(s) 680
Bso31I GGTCTC 1 cut(s) 82
Bsp143I GATC 6 cut(s) 81, 232, 268, 334, 358, 720
BspACI CCGC 2 cut(s) 119, 488
BspANI GGCC 1 cut(s) 680
BspCNI CTCAG 2 cut(s) 367, 635
BspLI GGNNCC 2 cut(s) 91, 537
BspMAI CTGCAG 1 cut(s) 246
BspTNI GGTCTC 1 cut(s) 82
BsrDI GCAATG 1 cut(s) 337
BsrI ACTGG 2 cut(s) 408, 608
BssECI CCNNGG 2 cut(s) 498, 562
BssMI GATC 6 cut(s) 81, 232, 268, 334, 358, 720
BssNI GRCGYC 1 cut(s) 132
BssSI CACGAG 1 cut(s) 28
Bst2BI CACGAG 1 cut(s) 28
Bst4CI ACNGT 6 cut(s) 71, 320, 455, 556, 563, 595
BstACI GRCGYC 1 cut(s) 132
BstC8I GCNNGC 4 cut(s) 126, 263, 328, 586
BstDEI CTNAG 2 cut(s) 375, 622
BstDSI CCRYGG 2 cut(s) 498, 562
BstF5I GGATG 5 cut(s) 135, 484, 494, 517, 706
BstH2I RGCGCY 1 cut(s) 693
BstHHI GCGC 1 cut(s) 692
BstKTI GATC 6 cut(s) 84, 235, 271, 337, 361, 723
BstMAI GTCTC 3 cut(s) 82, 188, 649
BstMBI GATC 6 cut(s) 81, 232, 268, 334, 358, 720
BstMCI CGRYCG 1 cut(s) 84
BstMWI GCNNNNNNNGC 4 cut(s) 96, 105, 125, 214
BstSFI CTRYAG 1 cut(s) 242
BstV1I GCAGC 4 cut(s) 195, 228, 256, 568
BstV2I GAAGAC 1 cut(s) 510
BsuRI GGCC 1 cut(s) 680
BtgI CCRYGG 2 cut(s) 498, 562
BtsCI GGATG 5 cut(s) 135, 484, 494, 517, 706
BtsIMutI CAGTG 2 cut(s) 228, 600
Cac8I GCNNGC 4 cut(s) 126, 263, 328, 586
CaiI CAGNNNCTG 1 cut(s) 453
CfoI GCGC 1 cut(s) 692
Cfr13I GGNCC 1 cut(s) 679
Csp6I GTAC 1 cut(s) 552
CspCI CAANNNNNGTGG 2 cut(s) 454, 489
CviAII CATG 2 cut(s) 338, 589
CviQI GTAC 1 cut(s) 552
DdeI CTNAG 2 cut(s) 375, 622
DpnI GATC 6 cut(s) 83, 234, 270, 336, 360, 722
DpnII GATC 6 cut(s) 81, 232, 268, 334, 358, 720
DriI GACNNNNNGTC 1 cut(s) 407
Eam1105I GACNNNNNGTC 1 cut(s) 407
EciI GGCGGA 1 cut(s) 134
Eco31I GGTCTC 1 cut(s) 82
Eco57I CTGAAG 1 cut(s) 515
Esp3I CGTCTC 1 cut(s) 188
FaeI CATG 2 cut(s) 341, 592
FaiI YATR 5 cut(s) 339, 354, 492, 590, 732
FatI CATG 2 cut(s) 337, 588
FbaI TGATCA 3 cut(s) 232, 268, 334
FblI GTMKAC 1 cut(s) 291
Fnu4HI GCNGC 4 cut(s) 209, 242, 245, 582
FokI GGATG 5 cut(s) 122, 471, 481, 524, 713
Fsp4HI GCNGC 4 cut(s) 209, 242, 245, 582
FspBI CTAG 1 cut(s) 687
GlaI GCGC 1 cut(s) 691
GluI GCNGC 4 cut(s) 209, 242, 245, 582
GsaI CCCAGC 1 cut(s) 195
HaeII RGCGCY 1 cut(s) 693
HaeIII GGCC 1 cut(s) 680
HhaI GCGC 1 cut(s) 692
Hin1I GRCGYC 1 cut(s) 132
Hin1II CATG 2 cut(s) 341, 592
Hin6I GCGC 1 cut(s) 690
HinP1I GCGC 1 cut(s) 690
HincII GTYRAC 1 cut(s) 292
HindII GTYRAC 1 cut(s) 292
HinfI GANTC 1 cut(s) 288
Hpy166II GTNNAC 2 cut(s) 292, 559
Hpy188I TCNGA 4 cut(s) 86, 94, 161, 625
Hpy188III TCNNGA 5 cut(s) 22, 49, 79, 236, 362
Hpy8I GTNNAC 2 cut(s) 292, 559
Hpy99I CGWCG 1 cut(s) 296
HpyCH4III ACNGT 6 cut(s) 71, 320, 455, 556, 563, 595
HpyCH4IV ACGT 1 cut(s) 132
HpyCH4V TGCA 4 cut(s) 244, 308, 330, 389
HpyF10VI GCNNNNNNNGC 4 cut(s) 96, 105, 125, 214
HpyF3I CTNAG 2 cut(s) 375, 622
HpySE526I ACGT 1 cut(s) 132
Hsp92I GRCGYC 1 cut(s) 132
Hsp92II CATG 2 cut(s) 341, 592
HspAI GCGC 1 cut(s) 690
Ksp22I TGATCA 3 cut(s) 232, 268, 334
Kzo9I GATC 6 cut(s) 81, 232, 268, 334, 358, 720
LmnI GCTCC 2 cut(s) 95, 121
Lsp1109I GCAGC 4 cut(s) 195, 228, 256, 568
LweI GCATC 1 cut(s) 180
MaeI CTAG 1 cut(s) 687
MaeII ACGT 1 cut(s) 132
MaeIII GTNAC 1 cut(s) 449
MalI GATC 6 cut(s) 83, 234, 270, 336, 360, 722
MboI GATC 6 cut(s) 81, 232, 268, 334, 358, 720
MboII GAAGA 2 cut(s) 515, 521
MfeI CAATTG 1 cut(s) 423
MluCI AATT 2 cut(s) 17, 423
MlyI GAGTC 1 cut(s) 297
MmeI TCCRAC 1 cut(s) 489
MseI TTAA 2 cut(s) 15, 736
MslI CAYNNNNRTG 1 cut(s) 593
MunI CAATTG 1 cut(s) 423
MwoI GCNNNNNNNGC 4 cut(s) 96, 105, 125, 214
NdeII GATC 6 cut(s) 81, 232, 268, 334, 358, 720
NlaIII CATG 2 cut(s) 341, 592
NlaIV GGNNCC 2 cut(s) 91, 537
PcsI WCGNNNNNNNCGW 2 cut(s) 56, 90
PkrI GCNGC 4 cut(s) 210, 243, 246, 583
Ple19I CGATCG 1 cut(s) 84
PleI GAGTC 1 cut(s) 296
PpsI GAGTC 1 cut(s) 296
PspFI CCCAGC 1 cut(s) 191
PspN4I GGNNCC 2 cut(s) 91, 537
PspPI GGNCC 1 cut(s) 679
PstI CTGCAG 1 cut(s) 246
PstNI CAGNNNCTG 1 cut(s) 453
PvuI CGATCG 1 cut(s) 84
RsaI GTAC 1 cut(s) 553
RsaNI GTAC 1 cut(s) 552
RseI CAYNNNNRTG 1 cut(s) 593
SalI GTCGAC 1 cut(s) 290
SaqAI TTAA 2 cut(s) 15, 736
SatI GCNGC 4 cut(s) 209, 242, 245, 582
Sau3AI GATC 6 cut(s) 81, 232, 268, 334, 358, 720
Sau96I GGNCC 1 cut(s) 679
SchI GAGTC 1 cut(s) 297
SfaNI GCATC 1 cut(s) 180
SfcI CTRYAG 1 cut(s) 242
SmiMI CAYNNNNRTG 1 cut(s) 593
SmlI CTYRAG 1 cut(s) 250
SmoI CTYRAG 1 cut(s) 250
Sse9I AATT 2 cut(s) 17, 423
SsiI CCGC 2 cut(s) 119, 488
SspI AATATT 1 cut(s) 436
SspMI CTAG 1 cut(s) 687
TaaI ACNGT 6 cut(s) 71, 320, 455, 556, 563, 595
TaiI ACGT 1 cut(s) 135
TaqI TCGA 5 cut(s) 21, 50, 80, 291, 723
TasI AATT 2 cut(s) 17, 423
Tru1I TTAA 2 cut(s) 15, 736
Tru9I TTAA 2 cut(s) 15, 736
TscAI CASTG 2 cut(s) 235, 600
TseI GCWGC 4 cut(s) 208, 241, 244, 581
TspDTI ATGAA 3 cut(s) 473, 528, 717
TspGWI ACGGA 1 cut(s) 487
TspRI CASTG 2 cut(s) 235, 600
XapI RAATTY 1 cut(s) 17
XmiI GTMKAC 1 cut(s) 291
XspI CTAG 1 cut(s) 687
ZraI GACGTC 1 cut(s) 133
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.