Rh1BG431000

Early nodulin-like protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Reverse (-)
54690206 .. 54690397
192 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG431000.1

Sequence Viewer

Length: 192 bp
ATGATTGTCAAAGTCTTGGGATCACCGGCTGCTGGAACAGAAAGCCCACCACCTGCTCAATCAGCAAACCAGAATGCAACTGAATCACCAGATCATCATGACATGAAGAACAATGCAGTTGCAATGCATGCTGTAGCTGCCATCTCTTTTACAAGTTCTGTAATATCATTTCTTGGGGTCTTTTTCTTCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

63

Amino Acids

6.54

Weight (kDa)

5.74

Isoelectric Point (pI)

67.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 61
Acc36I ACCTGC 1 cut(s) 61
AclWI GGATC 1 cut(s) 28
AfiI CCNNNNNNNGG 1 cut(s) 32
AluBI AGCT 1 cut(s) 137
AluI AGCT 1 cut(s) 137
AlwI GGATC 1 cut(s) 28
ApeKI GCWGC 2 cut(s) 29, 137
AsuHPI GGTGA 2 cut(s) 15, 78
BbvI GCAGC 2 cut(s) 16, 124
BccI CCATC 1 cut(s) 149
BfaI CTAG 1 cut(s) 190
BfmI CTRYAG 1 cut(s) 132
BfuAI ACCTGC 1 cut(s) 61
BisI GCNGC 2 cut(s) 30, 138
BlsI GCNGC 2 cut(s) 31, 139
Bsc4I CCNNNNNNNGG 1 cut(s) 32
Bse118I RCCGGY 1 cut(s) 25
Bse3DI GCAATG 1 cut(s) 129
BseLI CCNNNNNNNGG 1 cut(s) 32
BseMI GCAATG 1 cut(s) 129
BseXI GCAGC 2 cut(s) 16, 124
BsiSI CCGG 1 cut(s) 26
BslI CCNNNNNNNGG 1 cut(s) 32
BsmI GAATGC 1 cut(s) 79
Bsp143I GATC 2 cut(s) 20, 91
BspHI TCATGA 1 cut(s) 97
BspMI ACCTGC 1 cut(s) 61
BspPI GGATC 1 cut(s) 28
BsrDI GCAATG 1 cut(s) 129
BsrFI RCCGGY 1 cut(s) 25
BssAI RCCGGY 1 cut(s) 25
BssMI GATC 2 cut(s) 20, 91
BstAPI GCANNNNNTGC 1 cut(s) 128
BstC8I GCNNGC 1 cut(s) 129
BstKTI GATC 2 cut(s) 23, 94
BstMBI GATC 2 cut(s) 20, 91
BstMWI GCNNNNNNNGC 3 cut(s) 62, 128, 137
BstNSI RCATGY 1 cut(s) 131
BstSFI CTRYAG 1 cut(s) 132
BstV1I GCAGC 2 cut(s) 16, 124
BveI ACCTGC 1 cut(s) 61
Cac8I GCNNGC 1 cut(s) 129
CciI TCATGA 1 cut(s) 97
Cfr10I RCCGGY 1 cut(s) 25
CviAII CATG 3 cut(s) 98, 103, 128
CviJI RGCY 3 cut(s) 29, 45, 137
CviKI_1 RGCY 3 cut(s) 29, 45, 137
DpnI GATC 2 cut(s) 22, 93
DpnII GATC 2 cut(s) 20, 91
EcoT22I ATGCAT 1 cut(s) 129
FaeI CATG 3 cut(s) 101, 106, 131
FaiI YATR 3 cut(s) 99, 104, 129
FatI CATG 3 cut(s) 97, 102, 127
Fnu4HI GCNGC 2 cut(s) 30, 138
Fsp4HI GCNGC 2 cut(s) 30, 138
FspBI CTAG 1 cut(s) 190
GluI GCNGC 2 cut(s) 30, 138
HapII CCGG 1 cut(s) 26
Hin1II CATG 3 cut(s) 101, 106, 131
HinfI GANTC 1 cut(s) 83
HpaII CCGG 1 cut(s) 26
HphI GGTGA 2 cut(s) 15, 78
Hpy188III TCNNGA 1 cut(s) 98
HpyCH4V TGCA 4 cut(s) 77, 116, 122, 127
HpyF10VI GCNNNNNNNGC 3 cut(s) 62, 128, 137
Hsp92II CATG 3 cut(s) 101, 106, 131
Kzo9I GATC 2 cut(s) 20, 91
LpnPI CCDG 5 cut(s) 18, 39, 66, 83, 102
Lsp1109I GCAGC 2 cut(s) 16, 124
MaeI CTAG 1 cut(s) 190
MalI GATC 2 cut(s) 22, 93
MboI GATC 2 cut(s) 20, 91
MboII GAAGA 2 cut(s) 118, 178
Mph1103I ATGCAT 1 cut(s) 129
MspI CCGG 1 cut(s) 26
Mva1269I GAATGC 1 cut(s) 79
MwoI GCNNNNNNNGC 3 cut(s) 62, 128, 137
NdeII GATC 2 cut(s) 20, 91
NlaIII CATG 3 cut(s) 101, 106, 131
NsiI ATGCAT 1 cut(s) 129
NspI RCATGY 1 cut(s) 131
PaeI GCATGC 1 cut(s) 131
PagI TCATGA 1 cut(s) 97
PaqCI CACCTGC 1 cut(s) 61
PctI GAATGC 1 cut(s) 79
PfeI GAWTC 1 cut(s) 83
PkrI GCNGC 2 cut(s) 31, 139
SatI GCNGC 2 cut(s) 30, 138
Sau3AI GATC 2 cut(s) 20, 91
SetI ASST 2 cut(s) 55, 139
SfcI CTRYAG 1 cut(s) 132
SphI GCATGC 1 cut(s) 131
SspMI CTAG 1 cut(s) 190
TfiI GAWTC 1 cut(s) 83
TseI GCWGC 2 cut(s) 29, 137
TspDTI ATGAA 1 cut(s) 119
XceI RCATGY 1 cut(s) 131
XspI CTAG 1 cut(s) 190
Zsp2I ATGCAT 1 cut(s) 129
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.