Rh1CG141000

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
OG0002356
Physical Location & Seq
Forward (+)
30707733 .. 30729977
22245 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG141000.1

Sequence Viewer

Length: 165 bp
ATGGTTTCAGGTAATAAATCAGTTGAATCAACCGGGGATCAAACTATGGCCATCAAATGGATTTTGTCGGCTCCTTGCACAACTCCGGGTACTCGTTCATCCATTTCTGGCTCTTCAATGGATGATTCCTTGTACTGGGTTACACGATTTCAAGATAGGGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

54

Amino Acids

5.89

Weight (kDa)

5.95

Isoelectric Point (pI)

41.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 57
AclWI GGATC 1 cut(s) 45
AcoI YGGCCR 1 cut(s) 48
AfaI GTAC 2 cut(s) 91, 134
AfiI CCNNNNNNNGG 2 cut(s) 57, 135
AgsI TTSAA 3 cut(s) 26, 117, 152
AlwI GGATC 1 cut(s) 45
AoxI GGCC 1 cut(s) 48
AsuC2I CCSGG 2 cut(s) 34, 87
BalI TGGCCA 1 cut(s) 50
BccI CCATC 1 cut(s) 59
BcnI CCSGG 2 cut(s) 34, 87
Bme1390I CCNGG 2 cut(s) 34, 87
BmiI GGNNCC 1 cut(s) 72
BmrFI CCNGG 2 cut(s) 34, 87
BmrI ACTGGG 1 cut(s) 145
BmuI ACTGGG 1 cut(s) 145
BpuMI CCSGG 2 cut(s) 34, 87
BsaJI CCNNGG 1 cut(s) 33
Bsc4I CCNNNNNNNGG 2 cut(s) 57, 135
Bse1I ACTGG 1 cut(s) 140
BseDI CCNNGG 1 cut(s) 33
BseGI GGATG 2 cut(s) 98, 127
BseLI CCNNNNNNNGG 2 cut(s) 57, 135
BseNI ACTGG 1 cut(s) 140
BshFI GGCC 1 cut(s) 50
BsiSI CCGG 2 cut(s) 33, 86
BslI CCNNNNNNNGG 2 cut(s) 57, 135
BsnI GGCC 1 cut(s) 50
Bsp143I GATC 1 cut(s) 37
BspANI GGCC 1 cut(s) 50
BspLI GGNNCC 1 cut(s) 72
BspPI GGATC 1 cut(s) 45
BspQI GCTCTTC 1 cut(s) 118
BsrI ACTGG 1 cut(s) 140
BssECI CCNNGG 1 cut(s) 33
BssMI GATC 1 cut(s) 37
Bst6I CTCTTC 1 cut(s) 118
BstF5I GGATG 2 cut(s) 98, 127
BstKTI GATC 1 cut(s) 40
BstMBI GATC 1 cut(s) 37
BstSCI CCNGG 2 cut(s) 32, 85
BsuRI GGCC 1 cut(s) 50
BtsCI GGATG 2 cut(s) 98, 127
Csp6I GTAC 2 cut(s) 90, 133
CviJI RGCY 3 cut(s) 50, 71, 111
CviKI_1 RGCY 3 cut(s) 50, 71, 111
CviQI GTAC 2 cut(s) 90, 133
DpnI GATC 1 cut(s) 39
DpnII GATC 1 cut(s) 37
EaeI YGGCCR 1 cut(s) 48
Eam1104I CTCTTC 1 cut(s) 118
EarI CTCTTC 1 cut(s) 118
FaiI YATR 1 cut(s) 47
FokI GGATG 2 cut(s) 85, 134
HaeIII GGCC 1 cut(s) 50
HapII CCGG 2 cut(s) 33, 86
HinfI GANTC 2 cut(s) 26, 125
HpaII CCGG 2 cut(s) 33, 86
Hpy188III TCNNGA 1 cut(s) 152
HpyCH4V TGCA 1 cut(s) 78
Kzo9I GATC 1 cut(s) 37
LguI GCTCTTC 1 cut(s) 118
LmnI GCTCC 1 cut(s) 76
LpnPI CCDG 4 cut(s) 46, 93, 99, 121
MaeIII GTNAC 1 cut(s) 139
MalI GATC 1 cut(s) 39
MboI GATC 1 cut(s) 37
MboII GAAGA 1 cut(s) 105
MlsI TGGCCA 1 cut(s) 50
MluNI TGGCCA 1 cut(s) 50
Mox20I TGGCCA 1 cut(s) 50
MscI TGGCCA 1 cut(s) 50
Msp20I TGGCCA 1 cut(s) 50
MspI CCGG 2 cut(s) 33, 86
MspR9I CCNGG 2 cut(s) 34, 87
NciI CCSGG 2 cut(s) 34, 87
NdeII GATC 1 cut(s) 37
NlaIV GGNNCC 1 cut(s) 72
PciSI GCTCTTC 1 cut(s) 118
PfeI GAWTC 2 cut(s) 26, 125
PflMI CCANNNNNTGG 1 cut(s) 57
PspN4I GGNNCC 1 cut(s) 72
RsaI GTAC 2 cut(s) 91, 134
RsaNI GTAC 2 cut(s) 90, 133
SapI GCTCTTC 1 cut(s) 118
Sau3AI GATC 1 cut(s) 37
ScrFI CCNGG 2 cut(s) 34, 87
SetI ASST 1 cut(s) 13
StyD4I CCNGG 2 cut(s) 32, 85
TatI WGTACW 1 cut(s) 132
TfiI GAWTC 2 cut(s) 26, 125
TspDTI ATGAA 1 cut(s) 87
Van91I CCANNNNNTGG 1 cut(s) 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.