Rh2BG320000

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
OG0002281
Physical Location & Seq
Reverse (-)
38236326 .. 38237548
1223 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG320000.1

Sequence Viewer

Length: 480 bp
ATGCTGCTTGATTATCGCCCCCTTCCTGAAGATATTTCTCTTAGTGTCATTGGTTGGGATGCAAATCAATTCTTAATGGATAAGGATGCCGACTACGGAAAATACTGGAATGACTATCTGGTTTATAAGCACCATACCATCCGTACCGATGAGGTGCATGCATCACAAGCGTCCGAGTTGCTGGACATAATAGCTGGTCAAACATCCCTTATTTTCAAGTTGTGCATGGATGGCAATCACGAGTACCAACGAAGGCGAGCCTTGGAGGAGCAAATTGTTGCCAGCAATATCCTTCCTCCCGAGCATCGGACCTCTGGTCGTTCCTCCATTTCTTTAATCCCCCTTCAGCACGATAATGCGGATGACATAGGTGATATGCATGCAACAAACACTGATGAGTGTCAGCATGAGGCTGATGGTGCAAATTTAAGTCCGACCGATAACACTCAACCTCGCAAAAAACCAAGGAGGGTTCGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

159

Amino Acids

18.2

Weight (kDa)

5.25

Isoelectric Point (pI)

43.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 126
AciI CCGC 1 cut(s) 359
AcsI RAATTY 1 cut(s) 424
AcuI CTGAAG 2 cut(s) 48, 329
AfaI GTAC 2 cut(s) 145, 245
AfiI CCNNNNNNNGG 1 cut(s) 306
AgsI TTSAA 1 cut(s) 217
AhdI GACNNNNNGTC 1 cut(s) 315
AluBI AGCT 1 cut(s) 194
AluI AGCT 1 cut(s) 194
Ama87I CYCGRG 1 cut(s) 299
ApeKI GCWGC 1 cut(s) 4
ApoI RAATTY 1 cut(s) 424
AspS9I GGNCC 1 cut(s) 309
AsuHPI GGTGA 1 cut(s) 383
AvaI CYCGRG 1 cut(s) 299
AvaII GGWCC 1 cut(s) 309
BauI CACGAG 1 cut(s) 239
BccI CCATC 3 cut(s) 146, 224, 410
BisI GCNGC 1 cut(s) 5
BlsI GCNGC 1 cut(s) 6
Bme18I GGWCC 1 cut(s) 309
BmeRI GACNNNNNGTC 1 cut(s) 315
BmeT110I CYCGRG 1 cut(s) 299
BmgT120I GGNCC 1 cut(s) 309
BmsI GCATC 4 cut(s) 49, 76, 170, 313
BsaBI GATNNNNATC 2 cut(s) 63, 234
BsaJI CCNNGG 2 cut(s) 261, 464
Bsc4I CCNNNNNNNGG 1 cut(s) 306
Bse1I ACTGG 1 cut(s) 110
Bse8I GATNNNNATC 2 cut(s) 63, 234
BseDI CCNNGG 2 cut(s) 261, 464
BseGI GGATG 6 cut(s) 64, 91, 138, 203, 235, 367
BseJI GATNNNNATC 2 cut(s) 63, 234
BseLI CCNNNNNNNGG 1 cut(s) 306
BseNI ACTGG 1 cut(s) 110
BseRI GAGGAG 1 cut(s) 281
Bsh1285I CGRYCG 1 cut(s) 438
BsiEI CGRYCG 1 cut(s) 438
BsiHKCI CYCGRG 1 cut(s) 299
BslI CCNNNNNNNGG 1 cut(s) 306
BsoBI CYCGRG 1 cut(s) 299
BspACI CCGC 1 cut(s) 359
BsrI ACTGG 1 cut(s) 110
BssECI CCNNGG 2 cut(s) 261, 464
BssSI CACGAG 1 cut(s) 239
BssT1I CCWWGG 2 cut(s) 261, 464
Bst2BI CACGAG 1 cut(s) 239
BstC8I GCNNGC 4 cut(s) 159, 258, 283, 381
BstDEI CTNAG 1 cut(s) 41
BstF5I GGATG 6 cut(s) 64, 91, 138, 203, 235, 367
BstMCI CGRYCG 1 cut(s) 438
BstMWI GCNNNNNNNGC 3 cut(s) 167, 231, 419
BstNSI RCATGY 2 cut(s) 161, 383
BtsCI GGATG 6 cut(s) 64, 91, 138, 203, 235, 367
BtsIMutI CAGTG 1 cut(s) 390
Cac8I GCNNGC 4 cut(s) 159, 258, 283, 381
Cfr13I GGNCC 1 cut(s) 309
CseI GACGC 1 cut(s) 159
Csp6I GTAC 2 cut(s) 144, 244
CviAII CATG 4 cut(s) 158, 226, 380, 407
CviJI RGCY 3 cut(s) 194, 260, 413
CviKI_1 RGCY 3 cut(s) 194, 260, 413
CviQI GTAC 2 cut(s) 144, 244
DdeI CTNAG 1 cut(s) 41
DriI GACNNNNNGTC 1 cut(s) 315
Eam1105I GACNNNNNGTC 1 cut(s) 315
Eco130I CCWWGG 2 cut(s) 261, 464
Eco47I GGWCC 1 cut(s) 309
Eco57I CTGAAG 2 cut(s) 48, 329
Eco88I CYCGRG 1 cut(s) 299
EcoT14I CCWWGG 2 cut(s) 261, 464
EcoT22I ATGCAT 2 cut(s) 163, 381
ErhI CCWWGG 2 cut(s) 261, 464
FaeI CATG 4 cut(s) 161, 229, 383, 410
FaiI YATR 9 cut(s) 126, 135, 159, 188, 227, 368, 377, 381, 408
FatI CATG 4 cut(s) 157, 225, 379, 406
Fnu4HI GCNGC 1 cut(s) 5
FokI GGATG 6 cut(s) 71, 98, 125, 190, 242, 374
Fsp4HI GCNGC 1 cut(s) 5
GluI GCNGC 1 cut(s) 5
HgaI GACGC 1 cut(s) 159
Hin1II CATG 4 cut(s) 161, 229, 383, 410
HphI GGTGA 1 cut(s) 383
Hpy188I TCNGA 3 cut(s) 175, 309, 435
Hpy188III TCNNGA 3 cut(s) 26, 239, 299
HpyAV CCTTC 4 cut(s) 32, 246, 302, 353
HpyCH4V TGCA 7 cut(s) 62, 157, 161, 225, 379, 383, 422
HpyF10VI GCNNNNNNNGC 3 cut(s) 167, 231, 419
HpyF3I CTNAG 1 cut(s) 41
Hsp92II CATG 4 cut(s) 161, 229, 383, 410
LmnI GCTCC 1 cut(s) 268
LpnPI CCDG 7 cut(s) 39, 91, 104, 167, 180, 295, 300
LweI GCATC 4 cut(s) 49, 76, 170, 313
MboII GAAGA 1 cut(s) 41
MluCI AATT 3 cut(s) 68, 273, 424
MmeI TCCRAC 1 cut(s) 458
MnlI CCTC 8 cut(s) 145, 259, 306, 322, 334, 403, 462, 462
Mph1103I ATGCAT 2 cut(s) 163, 381
MseI TTAA 3 cut(s) 74, 335, 428
MslI CAYNNNNRTG 1 cut(s) 354
MwoI GCNNNNNNNGC 3 cut(s) 167, 231, 419
NlaIII CATG 4 cut(s) 161, 229, 383, 410
NsiI ATGCAT 2 cut(s) 163, 381
NspI RCATGY 2 cut(s) 161, 383
PaeI GCATGC 2 cut(s) 161, 383
PkrI GCNGC 1 cut(s) 6
PsiI TTATAA 1 cut(s) 126
PspPI GGNCC 1 cut(s) 309
RsaI GTAC 2 cut(s) 145, 245
RsaNI GTAC 2 cut(s) 144, 244
RseI CAYNNNNRTG 1 cut(s) 354
SaqAI TTAA 3 cut(s) 74, 335, 428
SatI GCNGC 1 cut(s) 5
Sau96I GGNCC 1 cut(s) 309
SetI ASST 5 cut(s) 156, 196, 314, 373, 454
SfaNI GCATC 4 cut(s) 49, 76, 170, 313
SinI GGWCC 1 cut(s) 309
SmiMI CAYNNNNRTG 1 cut(s) 354
SphI GCATGC 2 cut(s) 161, 383
Sse9I AATT 3 cut(s) 68, 273, 424
SsiI CCGC 1 cut(s) 359
StyI CCWWGG 2 cut(s) 261, 464
TaqII GACCGA 1 cut(s) 452
TasI AATT 3 cut(s) 68, 273, 424
Tru1I TTAA 3 cut(s) 74, 335, 428
Tru9I TTAA 3 cut(s) 74, 335, 428
TscAI CASTG 1 cut(s) 397
TseI GCWGC 1 cut(s) 4
TspGWI ACGGA 2 cut(s) 111, 131
TspRI CASTG 1 cut(s) 397
VpaK11BI GGWCC 1 cut(s) 309
XapI RAATTY 1 cut(s) 424
XceI RCATGY 2 cut(s) 161, 383
Zsp2I ATGCAT 2 cut(s) 163, 381
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.