Rh2CG298900

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2C
OG0002281
Physical Location & Seq
Reverse (-)
34648126 .. 34648697
572 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2CG298900.1

Sequence Viewer

Length: 339 bp
ATGGATTCACTCAATCGTGGAAAGACCGAGAGCATTGCTGGATTCTGGAGAGCTTGGGAGATATGGGCTTGGGAGTATTTGAAATCGTTGCCTCTGTTACATCCTTTCGGTGGAGATGACCGCTGGCCTCGGGCAACTCGTTGGTTTGGTGCAAAGGATGTCCGTGAATGGGCTCACAGCTTGAACGATTTCAGAGTCACACTTAGGTCCCTTACTTCTGATCAAATTGTCAGAGACCCTTGGGTGACCAATGACACATCTACTCCGCATTACGTCCTATCTAGCATTCCAGCCACGAAACTAAGGATTTTACTCGAAGGGCCAGCTGGTTACGCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

112

Amino Acids

12.97

Weight (kDa)

8.12

Isoelectric Point (pI)

34.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 121, 266
AfiI CCNNNNNNNGG 2 cut(s) 110, 169
AgsI TTSAA 2 cut(s) 82, 184
AluBI AGCT 3 cut(s) 53, 180, 326
AluI AGCT 3 cut(s) 53, 180, 326
Alw26I GTCTC 1 cut(s) 228
Ama87I CYCGRG 1 cut(s) 129
AoxI GGCC 2 cut(s) 125, 320
Asp700I GAANNNNTTC 1 cut(s) 188
AspS9I GGNCC 2 cut(s) 207, 320
AsuHPI GGTGA 1 cut(s) 256
AvaI CYCGRG 1 cut(s) 129
AvaII GGWCC 1 cut(s) 207
BanII GRGCYC 1 cut(s) 175
BcgI CGANNNNNNTGC 2 cut(s) 17, 51
BclI TGATCA 1 cut(s) 220
BcoDI GTCTC 1 cut(s) 228
BfaI CTAG 1 cut(s) 282
Bme18I GGWCC 1 cut(s) 207
BmeT110I CYCGRG 1 cut(s) 129
BmgT120I GGNCC 2 cut(s) 207, 320
BmiI GGNNCC 1 cut(s) 209
BpmI CTGGAG 1 cut(s) 67
BsaI GGTCTC 1 cut(s) 228
BsaJI CCNNGG 2 cut(s) 128, 239
BsaXI ACNNNNNCTCC 2 cut(s) 247, 277
Bsc4I CCNNNNNNNGG 2 cut(s) 110, 169
Bse3DI GCAATG 1 cut(s) 33
BseDI CCNNGG 2 cut(s) 128, 239
BseGI GGATG 2 cut(s) 100, 163
BseLI CCNNNNNNNGG 2 cut(s) 110, 169
BseMI GCAATG 1 cut(s) 33
BshFI GGCC 2 cut(s) 127, 322
BsiHKCI CYCGRG 1 cut(s) 129
BslFI GGGAC 1 cut(s) 193
BslI CCNNNNNNNGG 2 cut(s) 110, 169
BsmAI GTCTC 1 cut(s) 228
BsmFI GGGAC 1 cut(s) 193
BsmI GAATGC 1 cut(s) 285
BsnI GGCC 2 cut(s) 127, 322
Bso31I GGTCTC 1 cut(s) 228
BsoBI CYCGRG 1 cut(s) 129
Bsp1286I GDGCHC 1 cut(s) 175
Bsp143I GATC 1 cut(s) 220
BspACI CCGC 2 cut(s) 121, 266
BspANI GGCC 2 cut(s) 127, 322
BspLI GGNNCC 1 cut(s) 209
BspTNI GGTCTC 1 cut(s) 228
BsrDI GCAATG 1 cut(s) 33
BssECI CCNNGG 2 cut(s) 128, 239
BssMI GATC 1 cut(s) 220
BssT1I CCWWGG 1 cut(s) 239
BstC8I GCNNGC 2 cut(s) 125, 324
BstDEI CTNAG 3 cut(s) 203, 302, 336
BstEII GGTNACC 1 cut(s) 244
BstF5I GGATG 2 cut(s) 100, 163
BstKTI GATC 1 cut(s) 223
BstMAI GTCTC 1 cut(s) 228
BstMBI GATC 1 cut(s) 220
BstMWI GCNNNNNNNGC 1 cut(s) 332
BstPI GGTNACC 1 cut(s) 244
BsuRI GGCC 2 cut(s) 127, 322
BtsCI GGATG 2 cut(s) 100, 163
Cac8I GCNNGC 2 cut(s) 125, 324
Cfr13I GGNCC 2 cut(s) 207, 320
CviJI RGCY 8 cut(s) 53, 68, 127, 173, 180, 293, 322, 326
CviKI_1 RGCY 8 cut(s) 53, 68, 127, 173, 180, 293, 322, 326
DdeI CTNAG 3 cut(s) 203, 302, 336
DpnI GATC 1 cut(s) 222
DpnII GATC 1 cut(s) 220
Eco130I CCWWGG 1 cut(s) 239
Eco24I GRGCYC 1 cut(s) 175
Eco31I GGTCTC 1 cut(s) 228
Eco47I GGWCC 1 cut(s) 207
Eco88I CYCGRG 1 cut(s) 129
Eco91I GGTNACC 1 cut(s) 244
EcoO109I RGGNCCY 1 cut(s) 207
EcoO65I GGTNACC 1 cut(s) 244
EcoT14I CCWWGG 1 cut(s) 239
EcoT38I GRGCYC 1 cut(s) 175
ErhI CCWWGG 1 cut(s) 239
FaiI YATR 1 cut(s) 64
FaqI GGGAC 1 cut(s) 193
FbaI TGATCA 1 cut(s) 220
FokI GGATG 2 cut(s) 87, 170
FriOI GRGCYC 1 cut(s) 175
FspBI CTAG 1 cut(s) 282
GsuI CTGGAG 1 cut(s) 67
HaeIII GGCC 2 cut(s) 127, 322
HinfI GANTC 3 cut(s) 5, 42, 195
HphI GGTGA 1 cut(s) 256
Hpy188I TCNGA 3 cut(s) 194, 220, 233
Hpy188III TCNNGA 1 cut(s) 46
HpyAV CCTTC 1 cut(s) 311
HpyCH4IV ACGT 1 cut(s) 273
HpyCH4V TGCA 1 cut(s) 152
HpyF10VI GCNNNNNNNGC 1 cut(s) 332
HpyF3I CTNAG 3 cut(s) 203, 302, 336
HpySE526I ACGT 1 cut(s) 273
Ksp22I TGATCA 1 cut(s) 220
Kzo9I GATC 1 cut(s) 220
LpnPI CCDG 5 cut(s) 24, 31, 109, 303, 312
MaeI CTAG 1 cut(s) 282
MaeII ACGT 1 cut(s) 273
MaeIII GTNAC 4 cut(s) 96, 196, 244, 329
MalI GATC 1 cut(s) 222
MboI GATC 1 cut(s) 220
MhlI GDGCHC 1 cut(s) 175
MluCI AATT 1 cut(s) 225
MlyI GAGTC 1 cut(s) 204
MnlI CCTC 2 cut(s) 102, 138
MroXI GAANNNNTTC 1 cut(s) 188
MspA1I CMGCKG 2 cut(s) 123, 326
Mva1269I GAATGC 1 cut(s) 285
MwoI GCNNNNNNNGC 1 cut(s) 332
NdeII GATC 1 cut(s) 220
NlaIV GGNNCC 1 cut(s) 209
NmuCI GTSAC 2 cut(s) 196, 244
PcsI WCGNNNNNNNCGW 1 cut(s) 136
PctI GAATGC 1 cut(s) 285
PdmI GAANNNNTTC 1 cut(s) 188
PfeI GAWTC 2 cut(s) 5, 42
PleI GAGTC 1 cut(s) 203
PpsI GAGTC 1 cut(s) 203
PpuMI RGGWCCY 1 cut(s) 207
Psp5II RGGWCCY 1 cut(s) 207
PspEI GGTNACC 1 cut(s) 244
PspN4I GGNNCC 1 cut(s) 209
PspPI GGNCC 2 cut(s) 207, 320
PspPPI RGGWCCY 1 cut(s) 207
PvuII CAGCTG 1 cut(s) 326
Sau3AI GATC 1 cut(s) 220
Sau96I GGNCC 2 cut(s) 207, 320
SchI GAGTC 1 cut(s) 204
SduI GDGCHC 1 cut(s) 175
SetI ASST 5 cut(s) 55, 182, 209, 276, 328
SinI GGWCC 1 cut(s) 207
Sse9I AATT 1 cut(s) 225
SsiI CCGC 2 cut(s) 121, 266
SspMI CTAG 1 cut(s) 282
StyI CCWWGG 1 cut(s) 239
TaiI ACGT 1 cut(s) 276
TaqI TCGA 1 cut(s) 315
TaqII GACCGA 1 cut(s) 41
TasI AATT 1 cut(s) 225
TfiI GAWTC 2 cut(s) 5, 42
TseFI GTSAC 2 cut(s) 196, 244
Tsp45I GTSAC 2 cut(s) 196, 244
TspGWI ACGGA 1 cut(s) 152
VpaK11BI GGWCC 1 cut(s) 207
XmnI GAANNNNTTC 1 cut(s) 188
XspI CTAG 1 cut(s) 282
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.