Rh2DG235400

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2D
Physical Location & Seq
Reverse (-)
23416333 .. 23426374
10042 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2DG235400.1

Sequence Viewer

Length: 216 bp
ATGGTTGATAGCAACGCATCATCTACAAAGAAACGTGTTGAGTTTAATGCACGAGAACTCCTTGATGACATCCTTAAACCTGAGCTGACCAAAGACGGGCCTCTACGGCCTGGCATTGATGAAAGTGAAGTTGGAGTTGAAGTTGTGATTCAAGAAACTCCTATCAATTTGCAAAACATGAAGCATGCTAAAGCAATGGACCTAAATCACAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

7.94

Weight (kDa)

5.0

Isoelectric Point (pI)

39.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 96
AflIII ACRYGT 1 cut(s) 34
AgsI TTSAA 2 cut(s) 140, 152
AjnI CCWGG 1 cut(s) 109
AjuI GAANNNNNNNTTGG 2 cut(s) 114, 146
AluBI AGCT 1 cut(s) 85
AluI AGCT 1 cut(s) 85
AoxI GGCC 2 cut(s) 98, 107
AspS9I GGNCC 2 cut(s) 98, 199
AvaII GGWCC 1 cut(s) 199
BauI CACGAG 1 cut(s) 51
BceAI ACGGC 1 cut(s) 122
BciT130I CCWGG 1 cut(s) 111
BglI GCCNNNNNGGC 1 cut(s) 106
Bme1390I CCNGG 1 cut(s) 111
Bme18I GGWCC 1 cut(s) 199
BmgT120I GGNCC 2 cut(s) 98, 199
BmrFI CCNGG 1 cut(s) 111
BmsI GCATC 1 cut(s) 26
Bpu10I CCTNAGC 1 cut(s) 81
BsaXI ACNNNNNCTCC 4 cut(s) 42, 72, 126, 156
Bsc4I CCNNNNNNNGG 1 cut(s) 96
Bse3DI GCAATG 1 cut(s) 201
BseBI CCWGG 1 cut(s) 111
BseGI GGATG 1 cut(s) 69
BseLI CCNNNNNNNGG 1 cut(s) 96
BseMI GCAATG 1 cut(s) 201
BseMII CTCAG 1 cut(s) 72
BshFI GGCC 2 cut(s) 100, 109
BslI CCNNNNNNNGG 1 cut(s) 96
BsnI GGCC 2 cut(s) 100, 109
BspANI GGCC 2 cut(s) 100, 109
BspCNI CTCAG 1 cut(s) 73
BsrDI GCAATG 1 cut(s) 201
BssSI CACGAG 1 cut(s) 51
Bst2BI CACGAG 1 cut(s) 51
Bst2UI CCWGG 1 cut(s) 111
BstC8I GCNNGC 1 cut(s) 186
BstDEI CTNAG 1 cut(s) 81
BstF5I GGATG 1 cut(s) 69
BstMWI GCNNNNNNNGC 1 cut(s) 106
BstNI CCWGG 1 cut(s) 111
BstNSI RCATGY 1 cut(s) 188
BstSCI CCNGG 1 cut(s) 109
BsuRI GGCC 2 cut(s) 100, 109
BtsCI GGATG 1 cut(s) 69
Cac8I GCNNGC 1 cut(s) 186
Cfr13I GGNCC 2 cut(s) 98, 199
CviAII CATG 2 cut(s) 178, 185
CviJI RGCY 3 cut(s) 85, 100, 109
CviKI_1 RGCY 3 cut(s) 85, 100, 109
DdeI CTNAG 1 cut(s) 81
Eco47I GGWCC 1 cut(s) 199
EcoRII CCWGG 1 cut(s) 109
FaeI CATG 2 cut(s) 181, 188
FaiI YATR 2 cut(s) 179, 186
FatI CATG 2 cut(s) 177, 184
FokI GGATG 1 cut(s) 56
HaeIII GGCC 2 cut(s) 100, 109
Hin1II CATG 2 cut(s) 181, 188
HinfI GANTC 1 cut(s) 148
Hpy188III TCNNGA 1 cut(s) 152
HpyCH4IV ACGT 1 cut(s) 34
HpyCH4V TGCA 2 cut(s) 50, 172
HpyF10VI GCNNNNNNNGC 1 cut(s) 106
HpyF3I CTNAG 1 cut(s) 81
HpySE526I ACGT 1 cut(s) 34
Hsp92II CATG 2 cut(s) 181, 188
LpnPI CCDG 3 cut(s) 93, 96, 123
LweI GCATC 1 cut(s) 26
MaeII ACGT 1 cut(s) 34
MluCI AATT 2 cut(s) 166, 211
MmeI TCCRAC 1 cut(s) 112
MnlI CCTC 1 cut(s) 111
MseI TTAA 3 cut(s) 45, 75, 214
MspR9I CCNGG 1 cut(s) 111
MvaI CCWGG 1 cut(s) 111
MwoI GCNNNNNNNGC 1 cut(s) 106
NlaIII CATG 2 cut(s) 181, 188
NspI RCATGY 1 cut(s) 188
PaeI GCATGC 1 cut(s) 188
PfeI GAWTC 1 cut(s) 148
Psp6I CCWGG 1 cut(s) 109
PspGI CCWGG 1 cut(s) 109
PspPI GGNCC 2 cut(s) 98, 199
SaqAI TTAA 3 cut(s) 45, 75, 214
Sau96I GGNCC 2 cut(s) 98, 199
ScrFI CCNGG 1 cut(s) 111
SetI ASST 4 cut(s) 37, 82, 87, 204
SfaNI GCATC 1 cut(s) 26
SfiI GGCCNNNNNGGCC 1 cut(s) 106
SinI GGWCC 1 cut(s) 199
SphI GCATGC 1 cut(s) 188
Sse9I AATT 2 cut(s) 166, 211
StyD4I CCNGG 1 cut(s) 109
TaiI ACGT 1 cut(s) 37
TasI AATT 2 cut(s) 166, 211
TfiI GAWTC 1 cut(s) 148
Tru1I TTAA 3 cut(s) 45, 75, 214
Tru9I TTAA 3 cut(s) 45, 75, 214
TspDTI ATGAA 2 cut(s) 135, 194
VpaK11BI GGWCC 1 cut(s) 199
XceI RCATGY 1 cut(s) 188
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.