Rh3AG085600

E3 ubiquitin-protein ligase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
Physical Location & Seq
Reverse (-)
6889945 .. 6891576
1632 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG085600.1

Sequence Viewer

Length: 186 bp
ATGCAGTCACATGTTAAGAGATCAAAACTTCCTTCAGATGGAGCTGACTTTGTGATGGAAGATGTCCCATTATTGACTAATCTTCTGCAATATCATGATGCTAAGGAAGCTAAAGCATTATTAAGAAGATACAGATATCGTACAGGAACCATAGATGTTGCTTTACATGTATTTGAAGGGGAATAG

Protein Analysis

61

Amino Acids

7.03

Weight (kDa)

6.83

Isoelectric Point (pI)

39.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 18
AfaI GTAC 1 cut(s) 142
AfiI CCNNNNNNNGG 1 cut(s) 38
AflIII ACRYGT 2 cut(s) 10, 166
AgsI TTSAA 1 cut(s) 176
AluBI AGCT 2 cut(s) 44, 110
AluI AGCT 2 cut(s) 44, 110
BccI CCATC 2 cut(s) 32, 49
BmiI GGNNCC 1 cut(s) 148
BmsI GCATC 1 cut(s) 88
Bpu10I CCTNAGC 1 cut(s) 102
Bsc4I CCNNNNNNNGG 1 cut(s) 38
BseLI CCNNNNNNNGG 1 cut(s) 38
BslFI GGGAC 1 cut(s) 50
BslI CCNNNNNNNGG 1 cut(s) 38
BsmFI GGGAC 1 cut(s) 50
Bsp143I GATC 1 cut(s) 20
BspHI TCATGA 1 cut(s) 94
BspLI GGNNCC 1 cut(s) 148
BssMI GATC 1 cut(s) 20
BstDEI CTNAG 1 cut(s) 102
BstKTI GATC 1 cut(s) 23
BstMBI GATC 1 cut(s) 20
BstMWI GCNNNNNNNGC 1 cut(s) 107
BstNSI RCATGY 2 cut(s) 14, 170
CciI TCATGA 1 cut(s) 94
Csp6I GTAC 1 cut(s) 141
CviAII CATG 3 cut(s) 11, 95, 167
CviJI RGCY 2 cut(s) 44, 110
CviKI_1 RGCY 2 cut(s) 44, 110
CviQI GTAC 1 cut(s) 141
DdeI CTNAG 1 cut(s) 102
DpnI GATC 1 cut(s) 22
DpnII GATC 1 cut(s) 20
Eco32I GATATC 1 cut(s) 137
Eco57I CTGAAG 1 cut(s) 18
EcoRV GATATC 1 cut(s) 137
FaeI CATG 3 cut(s) 14, 98, 170
FaiI YATR 4 cut(s) 12, 96, 152, 168
FaqI GGGAC 1 cut(s) 50
FatI CATG 3 cut(s) 10, 94, 166
Hin1II CATG 3 cut(s) 14, 98, 170
Hpy188I TCNGA 1 cut(s) 37
Hpy188III TCNNGA 1 cut(s) 95
HpyAV CCTTC 2 cut(s) 42, 170
HpyCH4V TGCA 2 cut(s) 4, 88
HpyF10VI GCNNNNNNNGC 1 cut(s) 107
HpyF3I CTNAG 1 cut(s) 102
Hsp92II CATG 3 cut(s) 14, 98, 170
Kzo9I GATC 1 cut(s) 20
LmnI GCTCC 1 cut(s) 41
LpnPI CCDG 1 cut(s) 129
LweI GCATC 1 cut(s) 88
MaeIII GTNAC 1 cut(s) 6
MalI GATC 1 cut(s) 22
MboI GATC 1 cut(s) 20
MboII GAAGA 3 cut(s) 71, 74, 138
MseI TTAA 2 cut(s) 15, 122
MwoI GCNNNNNNNGC 1 cut(s) 107
NdeII GATC 1 cut(s) 20
NlaIII CATG 3 cut(s) 14, 98, 170
NlaIV GGNNCC 1 cut(s) 148
NmuCI GTSAC 1 cut(s) 6
NspI RCATGY 2 cut(s) 14, 170
PagI TCATGA 1 cut(s) 94
PciI ACATGT 2 cut(s) 10, 166
PscI ACATGT 2 cut(s) 10, 166
PspN4I GGNNCC 1 cut(s) 148
RsaI GTAC 1 cut(s) 142
RsaNI GTAC 1 cut(s) 141
SaqAI TTAA 2 cut(s) 15, 122
Sau3AI GATC 1 cut(s) 20
SetI ASST 2 cut(s) 46, 112
SfaNI GCATC 1 cut(s) 88
SgeI CNNG 4 cut(s) 23, 107, 156, 179
Tru1I TTAA 2 cut(s) 15, 122
Tru9I TTAA 2 cut(s) 15, 122
TseFI GTSAC 1 cut(s) 6
Tsp45I GTSAC 1 cut(s) 6
XceI RCATGY 2 cut(s) 14, 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.