Rh4AG396900

Folate receptor family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Reverse (-)
70206790 .. 70207382
593 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG396900.1

Sequence Viewer

Length: 204 bp
ATGGAACTATTGGAATGTTCCATCTGCGGTCCTCGCATTGGTGTGGAGCAAGGACCTCCAGTTCTATGTGCCTTGTTCTGTGACAGGGCCTTCAAGGCTTTTCCCGAGGCTTACTACTCGAGGGATGCAATAACACAGATTCATGGAAGGTCTCACAGTCGAAGGTGCCACAGAGGAGTGAGGAAATGCCAGTCAGCTCCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

67

Amino Acids

7.52

Weight (kDa)

8.91

Isoelectric Point (pI)

62.66

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 165
AciI CCGC 1 cut(s) 27
AfiI CCNNNNNNNGG 1 cut(s) 38
AgsI TTSAA 1 cut(s) 94
AloI GAACNNNNNNTCC 2 cut(s) 45, 77
AluBI AGCT 1 cut(s) 197
AluI AGCT 1 cut(s) 197
Alw26I GTCTC 1 cut(s) 156
Ama87I CYCGRG 2 cut(s) 104, 118
AoxI GGCC 1 cut(s) 87
AspS9I GGNCC 3 cut(s) 29, 53, 87
AvaI CYCGRG 2 cut(s) 104, 118
AvaII GGWCC 2 cut(s) 29, 53
BanI GGYRCC 1 cut(s) 165
BccI CCATC 1 cut(s) 29
BcoDI GTCTC 1 cut(s) 156
BglI GCCNNNNNGGC 1 cut(s) 95
Bme18I GGWCC 2 cut(s) 29, 53
BmeT110I CYCGRG 2 cut(s) 104, 118
BmgT120I GGNCC 3 cut(s) 29, 53, 87
BmiI GGNNCC 1 cut(s) 167
BmsI GCATC 1 cut(s) 115
BpmI CTGGAG 1 cut(s) 42
BsaI GGTCTC 1 cut(s) 156
BsaJI CCNNGG 1 cut(s) 105
Bsc4I CCNNNNNNNGG 1 cut(s) 38
Bse1I ACTGG 2 cut(s) 59, 190
BseDI CCNNGG 1 cut(s) 105
BseGI GGATG 1 cut(s) 130
BseLI CCNNNNNNNGG 1 cut(s) 38
BseNI ACTGG 2 cut(s) 59, 190
BseRI GAGGAG 1 cut(s) 189
BshFI GGCC 1 cut(s) 89
BshNI GGYRCC 1 cut(s) 165
BsiHKCI CYCGRG 2 cut(s) 104, 118
BslI CCNNNNNNNGG 1 cut(s) 38
BsmAI GTCTC 1 cut(s) 156
BsnI GGCC 1 cut(s) 89
Bso31I GGTCTC 1 cut(s) 156
BsoBI CYCGRG 2 cut(s) 104, 118
BspACI CCGC 1 cut(s) 27
BspANI GGCC 1 cut(s) 89
BspLI GGNNCC 1 cut(s) 167
BspT107I GGYRCC 1 cut(s) 165
BspTNI GGTCTC 1 cut(s) 156
BsrI ACTGG 2 cut(s) 59, 190
BssECI CCNNGG 1 cut(s) 105
Bst4CI ACNGT 1 cut(s) 158
BstF5I GGATG 1 cut(s) 130
BstMAI GTCTC 1 cut(s) 156
BstMWI GCNNNNNNNGC 2 cut(s) 33, 95
BsuRI GGCC 1 cut(s) 89
BtsCI GGATG 1 cut(s) 130
Cfr13I GGNCC 3 cut(s) 29, 53, 87
CviAII CATG 2 cut(s) 143, 201
CviJI RGCY 4 cut(s) 89, 98, 110, 197
CviKI_1 RGCY 4 cut(s) 89, 98, 110, 197
Eco31I GGTCTC 1 cut(s) 156
Eco47I GGWCC 2 cut(s) 29, 53
Eco88I CYCGRG 2 cut(s) 104, 118
EcoO109I RGGNCCY 2 cut(s) 53, 87
FaeI CATG 2 cut(s) 146, 204
FaiI YATR 3 cut(s) 67, 144, 202
FatI CATG 2 cut(s) 142, 200
FokI GGATG 1 cut(s) 137
GsuI CTGGAG 1 cut(s) 42
HaeIII GGCC 1 cut(s) 89
Hin1II CATG 2 cut(s) 146, 204
HinfI GANTC 1 cut(s) 139
Hpy188III TCNNGA 1 cut(s) 104
HpyAV CCTTC 3 cut(s) 100, 141, 156
HpyCH4III ACNGT 1 cut(s) 158
HpyCH4V TGCA 1 cut(s) 128
HpyF10VI GCNNNNNNNGC 2 cut(s) 33, 95
Hsp92II CATG 2 cut(s) 146, 204
LmnI GCTCC 2 cut(s) 46, 202
LpnPI CCDG 2 cut(s) 70, 72
LweI GCATC 1 cut(s) 115
MaeIII GTNAC 1 cut(s) 80
MnlI CCTC 6 cut(s) 42, 66, 100, 114, 167, 174
MslI CAYNNNNRTG 1 cut(s) 41
MwoI GCNNNNNNNGC 2 cut(s) 33, 95
NlaIII CATG 2 cut(s) 146, 204
NlaIV GGNNCC 1 cut(s) 167
NmuCI GTSAC 1 cut(s) 80
PaeR7I CTCGAG 1 cut(s) 118
PfeI GAWTC 1 cut(s) 139
PpuMI RGGWCCY 1 cut(s) 53
Psp5II RGGWCCY 1 cut(s) 53
PspN4I GGNNCC 1 cut(s) 167
PspPI GGNCC 3 cut(s) 29, 53, 87
PspPPI RGGWCCY 1 cut(s) 53
PspXI VCTCGAGB 1 cut(s) 118
RseI CAYNNNNRTG 1 cut(s) 41
Sau96I GGNCC 3 cut(s) 29, 53, 87
SetI ASST 4 cut(s) 58, 152, 167, 199
SfaNI GCATC 1 cut(s) 115
Sfr274I CTCGAG 1 cut(s) 118
SinI GGWCC 2 cut(s) 29, 53
SlaI CTCGAG 1 cut(s) 118
SmiMI CAYNNNNRTG 1 cut(s) 41
SmlI CTYRAG 1 cut(s) 118
SmoI CTYRAG 1 cut(s) 118
SsiI CCGC 1 cut(s) 27
TaaI ACNGT 1 cut(s) 158
TaqI TCGA 2 cut(s) 119, 160
TfiI GAWTC 1 cut(s) 139
TseFI GTSAC 1 cut(s) 80
Tsp45I GTSAC 1 cut(s) 80
TspDTI ATGAA 1 cut(s) 131
VpaK11BI GGWCC 2 cut(s) 29, 53
XhoI CTCGAG 1 cut(s) 118
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.