Rh3DG189700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3D
Physical Location & Seq
Forward (+)
16906389 .. 16907473
1085 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3DG189700.1

Sequence Viewer

Length: 555 bp
ATGGGTGTTCTTAATGTTATCGGAGTTACAGCAGTTCTACTGCTATTTTTCATAAGCATGCAATTGTCTGAGGCTGGCAGGGTGTTGCATGACGAGGACGAAAACTTGACGAAGAAGGCTGTTCTTCCTCCCGGTGGACCTAATCCTACCACCAACGTGCCTGGTCCTGCGACTCCTACTAGCGGTCATACTGCAACCATTAACCAAAGAAACTTTGCAGGCCACACTACTACAGAAAACTTGACGAAGAACAAACTTTTCGTTTTAATGGAGTCGAAGCAGAAAGGTGGTCAGCCTCCCCAGGGACCTAATCCTCCCACCAACGTGCCTGGTCCTGCGACAACTTCTAGCGGTCATGCTGCAACCATTAACCAAAGAAACTTTGCAGGCCACACTACTACAGAAAACTTGACGAAGAACAAACTTTTCGTTTTAATGGAGTCGAAGCAGAAAGGTGATCCCCGTTCCGGTGGACATAATCCGACCACCACCACGCCTGGTCCTAAGCCTCTTGCTAGTGGTCGTGCTGTTTCAACCATTAACCAAAGAAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

184

Amino Acids

19.34

Weight (kDa)

10.07

Isoelectric Point (pI)

30.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 183, 351
AclWI GGATC 1 cut(s) 452
AfiI CCNNNNNNNGG 4 cut(s) 134, 182, 302, 467
AgsI TTSAA 1 cut(s) 534
AjnI CCWGG 4 cut(s) 160, 300, 328, 496
AleI CACNNNNGTG 2 cut(s) 155, 323
AlwI GGATC 1 cut(s) 452
AoxI GGCC 2 cut(s) 220, 388
ApeKI GCWGC 1 cut(s) 359
AspS9I GGNCC 5 cut(s) 137, 164, 305, 332, 500
AsuC2I CCSGG 1 cut(s) 132
AsuHPI GGTGA 1 cut(s) 467
AvaII GGWCC 5 cut(s) 137, 164, 305, 332, 500
BbvI GCAGC 1 cut(s) 346
BciT130I CCWGG 4 cut(s) 162, 302, 330, 498
BcnI CCSGG 1 cut(s) 132
BfaI CTAG 3 cut(s) 180, 348, 516
BfmI CTRYAG 2 cut(s) 231, 399
BisI GCNGC 1 cut(s) 360
BlsI GCNGC 1 cut(s) 361
Bme1390I CCNGG 5 cut(s) 132, 162, 302, 330, 498
Bme18I GGWCC 5 cut(s) 137, 164, 305, 332, 500
BmgT120I GGNCC 5 cut(s) 137, 164, 305, 332, 500
BmiI GGNNCC 1 cut(s) 306
BmrFI CCNGG 5 cut(s) 132, 162, 302, 330, 498
Bpu10I CCTNAGC 1 cut(s) 504
BpuMI CCSGG 1 cut(s) 132
BsaJI CCNNGG 2 cut(s) 300, 301
BsaWI WCCGGW 1 cut(s) 467
Bsc4I CCNNNNNNNGG 4 cut(s) 134, 182, 302, 467
BseBI CCWGG 4 cut(s) 162, 302, 330, 498
BseDI CCNNGG 2 cut(s) 300, 301
BseLI CCNNNNNNNGG 4 cut(s) 134, 182, 302, 467
BseMII CTCAG 1 cut(s) 60
BseXI GCAGC 1 cut(s) 346
BshFI GGCC 2 cut(s) 222, 390
BsiSI CCGG 2 cut(s) 132, 468
BslFI GGGAC 1 cut(s) 318
BslI CCNNNNNNNGG 4 cut(s) 134, 182, 302, 467
BsmFI GGGAC 1 cut(s) 318
BsnI GGCC 2 cut(s) 222, 390
Bsp143I GATC 1 cut(s) 457
BspACI CCGC 2 cut(s) 183, 351
BspANI GGCC 2 cut(s) 222, 390
BspCNI CTCAG 1 cut(s) 61
BspLI GGNNCC 1 cut(s) 306
BspPI GGATC 1 cut(s) 452
BssECI CCNNGG 2 cut(s) 300, 301
BssMI GATC 1 cut(s) 457
Bst2UI CCWGG 4 cut(s) 162, 302, 330, 498
BstC8I GCNNGC 4 cut(s) 59, 76, 220, 388
BstDEI CTNAG 2 cut(s) 69, 504
BstKTI GATC 1 cut(s) 460
BstMBI GATC 1 cut(s) 457
BstNI CCWGG 4 cut(s) 162, 302, 330, 498
BstNSI RCATGY 1 cut(s) 61
BstSCI CCNGG 5 cut(s) 130, 160, 300, 328, 496
BstSFI CTRYAG 2 cut(s) 231, 399
BstV1I GCAGC 1 cut(s) 346
BsuRI GGCC 2 cut(s) 222, 390
Cac8I GCNNGC 4 cut(s) 59, 76, 220, 388
Cfr13I GGNCC 5 cut(s) 137, 164, 305, 332, 500
CviAII CATG 3 cut(s) 58, 89, 356
CviJI RGCY 6 cut(s) 74, 119, 222, 295, 390, 508
CviKI_1 RGCY 6 cut(s) 74, 119, 222, 295, 390, 508
DdeI CTNAG 2 cut(s) 69, 504
DpnI GATC 1 cut(s) 459
DpnII GATC 1 cut(s) 457
Eco47I GGWCC 5 cut(s) 137, 164, 305, 332, 500
EcoO109I RGGNCCY 1 cut(s) 305
EcoRII CCWGG 4 cut(s) 160, 300, 328, 496
FaeI CATG 3 cut(s) 61, 92, 359
FaiI YATR 6 cut(s) 53, 59, 90, 189, 357, 477
FaqI GGGAC 1 cut(s) 318
FatI CATG 3 cut(s) 57, 88, 355
Fnu4HI GCNGC 1 cut(s) 360
Fsp4HI GCNGC 1 cut(s) 360
FspBI CTAG 3 cut(s) 180, 348, 516
GluI GCNGC 1 cut(s) 360
HaeIII GGCC 2 cut(s) 222, 390
HapII CCGG 2 cut(s) 132, 468
Hin1II CATG 3 cut(s) 61, 92, 359
HinfI GANTC 3 cut(s) 172, 272, 440
HpaII CCGG 2 cut(s) 132, 468
HphI GGTGA 1 cut(s) 467
Hpy166II GTNNAC 2 cut(s) 137, 473
Hpy188I TCNGA 3 cut(s) 23, 70, 483
Hpy8I GTNNAC 2 cut(s) 137, 473
HpyAV CCTTC 1 cut(s) 109
HpyCH4IV ACGT 2 cut(s) 156, 324
HpyCH4V TGCA 6 cut(s) 61, 88, 194, 218, 362, 386
HpyF3I CTNAG 2 cut(s) 69, 504
HpySE526I ACGT 2 cut(s) 156, 324
Hsp92II CATG 3 cut(s) 61, 92, 359
Kzo9I GATC 1 cut(s) 457
Lsp1109I GCAGC 1 cut(s) 346
MaeI CTAG 3 cut(s) 180, 348, 516
MaeII ACGT 2 cut(s) 156, 324
MaeIII GTNAC 1 cut(s) 25
MalI GATC 1 cut(s) 459
MboI GATC 1 cut(s) 457
MboII GAAGA 4 cut(s) 116, 124, 259, 427
MfeI CAATTG 1 cut(s) 62
MluCI AATT 2 cut(s) 62, 550
MlyI GAGTC 3 cut(s) 166, 281, 449
MmeI TCCRAC 1 cut(s) 506
MnlI CCTC 6 cut(s) 64, 88, 138, 306, 324, 519
MseI TTAA 7 cut(s) 12, 201, 266, 369, 434, 540, 553
MslI CAYNNNNRTG 3 cut(s) 56, 155, 323
MspI CCGG 2 cut(s) 132, 468
MspR9I CCNGG 5 cut(s) 132, 162, 302, 330, 498
MunI CAATTG 1 cut(s) 62
MvaI CCWGG 4 cut(s) 162, 302, 330, 498
NciI CCSGG 1 cut(s) 132
NdeII GATC 1 cut(s) 457
NlaIII CATG 3 cut(s) 61, 92, 359
NlaIV GGNNCC 1 cut(s) 306
NspI RCATGY 1 cut(s) 61
OliI CACNNNNGTG 2 cut(s) 155, 323
PaeI GCATGC 1 cut(s) 61
PasI CCCWGGG 1 cut(s) 301
PkrI GCNGC 1 cut(s) 361
PleI GAGTC 3 cut(s) 166, 280, 448
PpsI GAGTC 3 cut(s) 166, 280, 448
PpuMI RGGWCCY 1 cut(s) 305
Psp5II RGGWCCY 1 cut(s) 305
Psp6I CCWGG 4 cut(s) 160, 300, 328, 496
PspGI CCWGG 4 cut(s) 160, 300, 328, 496
PspN4I GGNNCC 1 cut(s) 306
PspPI GGNCC 5 cut(s) 137, 164, 305, 332, 500
PspPPI RGGWCCY 1 cut(s) 305
RseI CAYNNNNRTG 3 cut(s) 56, 155, 323
SaqAI TTAA 7 cut(s) 12, 201, 266, 369, 434, 540, 553
SatI GCNGC 1 cut(s) 360
Sau3AI GATC 1 cut(s) 457
Sau96I GGNCC 5 cut(s) 137, 164, 305, 332, 500
SchI GAGTC 3 cut(s) 166, 281, 449
ScrFI CCNGG 5 cut(s) 132, 162, 302, 330, 498
SetI ASST 6 cut(s) 142, 159, 289, 310, 327, 457
SfcI CTRYAG 2 cut(s) 231, 399
SinI GGWCC 5 cut(s) 137, 164, 305, 332, 500
SmiMI CAYNNNNRTG 3 cut(s) 56, 155, 323
SphI GCATGC 1 cut(s) 61
Sse9I AATT 2 cut(s) 62, 550
SsiI CCGC 2 cut(s) 183, 351
SspMI CTAG 3 cut(s) 180, 348, 516
StyD4I CCNGG 5 cut(s) 130, 160, 300, 328, 496
TaiI ACGT 2 cut(s) 159, 327
TaqI TCGA 2 cut(s) 275, 443
TasI AATT 2 cut(s) 62, 550
Tru1I TTAA 7 cut(s) 12, 201, 266, 369, 434, 540, 553
Tru9I TTAA 7 cut(s) 12, 201, 266, 369, 434, 540, 553
TseI GCWGC 1 cut(s) 359
TspDTI ATGAA 1 cut(s) 40
VpaK11BI GGWCC 5 cut(s) 137, 164, 305, 332, 500
XceI RCATGY 1 cut(s) 61
XspI CTAG 3 cut(s) 180, 348, 516
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.