Rh6DG315200

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
OG0002148
Physical Location & Seq
Forward (+)
51678949 .. 51679800
852 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG315200.1

Sequence Viewer

Length: 558 bp
ATGGGTGTTCTTAATGTTATCGGAGTTACAGCAGTTCTACTGCTATTTTTCATAAGCATGCAATTGTCTGAGGCTGGCAGGGTGTTGCATGACGAGGACGAAAACTTGACGAAGAAGGCTGTTCTTCCTCCCGGTGGACCTAATGGTCACACCAACGTTCCTGGTCCTGCGACTCCTACTAGTGGTCATGCTGCAACCATTAACCAAAGAAACTTTGCAGGCCACATTACTACAGAAAACTCGACGAAGAACAAACTTTTCGTTTTAATGGAGTCGAAGCAGAAAGGTGGACGCCCTCCCCAGGGACCTAATCCTCCCACCAACGTGCCTGGTCCTAAGCCTCCTGCTAGTGGTCATGCTGCTTCAACCATTAACCAAAGAAACTTTGCAGGCCACACCACTGTAGAAAACTTGACGAAGAACAAACTTTTCGTTTTAATGGAGTCGAAGCAGAAAGGTGATCCCCCTTCCGGTGGACATAATCCGACCACCAACACGCCTGGTCCTAAGCCTCCTGCTAGTGGTCATGCTGCTTCAACCATTAACCAAAGAAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

185

Amino Acids

19.33

Weight (kDa)

9.99

Isoelectric Point (pI)

32.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 144
AclI AACGTT 1 cut(s) 156
AclWI GGATC 1 cut(s) 455
AcyI GRCGYC 1 cut(s) 292
AfiI CCNNNNNNNGG 8 cut(s) 134, 182, 301, 302, 350, 470, 473, 521
AgsI TTSAA 2 cut(s) 366, 537
AhlI ACTAGT 1 cut(s) 179
AjnI CCWGG 4 cut(s) 160, 300, 328, 499
AleI CACNNNNGTG 1 cut(s) 323
AlwI GGATC 1 cut(s) 455
AoxI GGCC 2 cut(s) 220, 391
ApeKI GCWGC 3 cut(s) 191, 359, 530
AspS9I GGNCC 5 cut(s) 137, 164, 305, 332, 503
AsuC2I CCSGG 1 cut(s) 132
AsuHPI GGTGA 1 cut(s) 470
AvaII GGWCC 5 cut(s) 137, 164, 305, 332, 503
BbvI GCAGC 3 cut(s) 178, 346, 517
BciT130I CCWGG 4 cut(s) 162, 302, 330, 501
BcnI CCSGG 1 cut(s) 132
BcuI ACTAGT 1 cut(s) 179
BfaI CTAG 3 cut(s) 180, 348, 519
BfmI CTRYAG 2 cut(s) 231, 402
BisI GCNGC 3 cut(s) 192, 360, 531
BlsI GCNGC 3 cut(s) 193, 361, 532
Bme1390I CCNGG 5 cut(s) 132, 162, 302, 330, 501
Bme18I GGWCC 5 cut(s) 137, 164, 305, 332, 503
BmgT120I GGNCC 5 cut(s) 137, 164, 305, 332, 503
BmiI GGNNCC 1 cut(s) 306
BmrFI CCNGG 5 cut(s) 132, 162, 302, 330, 501
Bpu10I CCTNAGC 2 cut(s) 336, 507
BpuMI CCSGG 1 cut(s) 132
BsaHI GRCGYC 1 cut(s) 292
BsaJI CCNNGG 2 cut(s) 300, 301
BsaWI WCCGGW 1 cut(s) 470
Bsc4I CCNNNNNNNGG 8 cut(s) 134, 182, 301, 302, 350, 470, 473, 521
BseBI CCWGG 4 cut(s) 162, 302, 330, 501
BseDI CCNNGG 2 cut(s) 300, 301
BseLI CCNNNNNNNGG 8 cut(s) 134, 182, 301, 302, 350, 470, 473, 521
BseMII CTCAG 1 cut(s) 60
BseXI GCAGC 3 cut(s) 178, 346, 517
BshFI GGCC 2 cut(s) 222, 393
BsiSI CCGG 2 cut(s) 132, 471
BslFI GGGAC 1 cut(s) 318
BslI CCNNNNNNNGG 8 cut(s) 134, 182, 301, 302, 350, 470, 473, 521
BsmFI GGGAC 1 cut(s) 318
BsnI GGCC 2 cut(s) 222, 393
Bsp143I GATC 1 cut(s) 460
BspANI GGCC 2 cut(s) 222, 393
BspCNI CTCAG 1 cut(s) 61
BspLI GGNNCC 1 cut(s) 306
BspPI GGATC 1 cut(s) 455
BssECI CCNNGG 2 cut(s) 300, 301
BssMI GATC 1 cut(s) 460
BssNI GRCGYC 1 cut(s) 292
Bst2UI CCWGG 4 cut(s) 162, 302, 330, 501
Bst4CI ACNGT 1 cut(s) 403
BstACI GRCGYC 1 cut(s) 292
BstC8I GCNNGC 4 cut(s) 59, 76, 220, 391
BstDEI CTNAG 3 cut(s) 69, 336, 507
BstKTI GATC 1 cut(s) 463
BstMBI GATC 1 cut(s) 460
BstNI CCWGG 4 cut(s) 162, 302, 330, 501
BstNSI RCATGY 1 cut(s) 61
BstSCI CCNGG 5 cut(s) 130, 160, 300, 328, 499
BstSFI CTRYAG 2 cut(s) 231, 402
BstV1I GCAGC 3 cut(s) 178, 346, 517
BsuRI GGCC 2 cut(s) 222, 393
BtsIMutI CAGTG 1 cut(s) 399
Cac8I GCNNGC 4 cut(s) 59, 76, 220, 391
Cfr13I GGNCC 5 cut(s) 137, 164, 305, 332, 503
CseI GACGC 1 cut(s) 300
CviAII CATG 5 cut(s) 58, 89, 188, 356, 527
CviJI RGCY 6 cut(s) 74, 119, 222, 340, 393, 511
CviKI_1 RGCY 6 cut(s) 74, 119, 222, 340, 393, 511
DdeI CTNAG 3 cut(s) 69, 336, 507
DpnI GATC 1 cut(s) 462
DpnII GATC 1 cut(s) 460
DrdI GACNNNNNNGTC 1 cut(s) 144
DseDI GACNNNNNNGTC 1 cut(s) 144
Eco47I GGWCC 5 cut(s) 137, 164, 305, 332, 503
EcoO109I RGGNCCY 1 cut(s) 305
EcoRII CCWGG 4 cut(s) 160, 300, 328, 499
FaeI CATG 5 cut(s) 61, 92, 191, 359, 530
FaiI YATR 7 cut(s) 53, 59, 90, 189, 357, 480, 528
FaqI GGGAC 1 cut(s) 318
FatI CATG 5 cut(s) 57, 88, 187, 355, 526
Fnu4HI GCNGC 3 cut(s) 192, 360, 531
Fsp4HI GCNGC 3 cut(s) 192, 360, 531
FspBI CTAG 3 cut(s) 180, 348, 519
GluI GCNGC 3 cut(s) 192, 360, 531
HaeIII GGCC 2 cut(s) 222, 393
HapII CCGG 2 cut(s) 132, 471
HgaI GACGC 1 cut(s) 300
Hin1I GRCGYC 1 cut(s) 292
Hin1II CATG 5 cut(s) 61, 92, 191, 359, 530
HinfI GANTC 3 cut(s) 172, 272, 443
HpaII CCGG 2 cut(s) 132, 471
HphI GGTGA 1 cut(s) 470
Hpy166II GTNNAC 3 cut(s) 137, 290, 476
Hpy188I TCNGA 3 cut(s) 23, 70, 486
Hpy8I GTNNAC 3 cut(s) 137, 290, 476
Hpy99I CGWCG 1 cut(s) 247
HpyAV CCTTC 2 cut(s) 109, 477
HpyCH4III ACNGT 1 cut(s) 403
HpyCH4IV ACGT 2 cut(s) 156, 324
HpyCH4V TGCA 5 cut(s) 61, 88, 194, 218, 389
HpyF3I CTNAG 3 cut(s) 69, 336, 507
HpySE526I ACGT 2 cut(s) 156, 324
Hsp92I GRCGYC 1 cut(s) 292
Hsp92II CATG 5 cut(s) 61, 92, 191, 359, 530
Kzo9I GATC 1 cut(s) 460
Lsp1109I GCAGC 3 cut(s) 178, 346, 517
MaeI CTAG 3 cut(s) 180, 348, 519
MaeII ACGT 2 cut(s) 156, 324
MaeIII GTNAC 2 cut(s) 25, 146
MalI GATC 1 cut(s) 462
MboI GATC 1 cut(s) 460
MboII GAAGA 4 cut(s) 116, 124, 259, 430
MfeI CAATTG 1 cut(s) 62
MluCI AATT 2 cut(s) 62, 553
MlyI GAGTC 3 cut(s) 166, 281, 452
MmeI TCCRAC 1 cut(s) 509
MnlI CCTC 7 cut(s) 64, 88, 138, 306, 324, 351, 522
MseI TTAA 7 cut(s) 12, 201, 266, 372, 437, 543, 556
MslI CAYNNNNRTG 2 cut(s) 56, 323
MspI CCGG 2 cut(s) 132, 471
MspR9I CCNGG 5 cut(s) 132, 162, 302, 330, 501
MunI CAATTG 1 cut(s) 62
MvaI CCWGG 4 cut(s) 162, 302, 330, 501
NciI CCSGG 1 cut(s) 132
NdeII GATC 1 cut(s) 460
NlaIII CATG 5 cut(s) 61, 92, 191, 359, 530
NlaIV GGNNCC 1 cut(s) 306
NmuCI GTSAC 1 cut(s) 146
NspI RCATGY 1 cut(s) 61
OliI CACNNNNGTG 1 cut(s) 323
PaeI GCATGC 1 cut(s) 61
PasI CCCWGGG 1 cut(s) 301
PkrI GCNGC 3 cut(s) 193, 361, 532
PleI GAGTC 3 cut(s) 166, 280, 451
PpsI GAGTC 3 cut(s) 166, 280, 451
PpuMI RGGWCCY 1 cut(s) 305
Psp1406I AACGTT 1 cut(s) 156
Psp5II RGGWCCY 1 cut(s) 305
Psp6I CCWGG 4 cut(s) 160, 300, 328, 499
PspGI CCWGG 4 cut(s) 160, 300, 328, 499
PspN4I GGNNCC 1 cut(s) 306
PspPI GGNCC 5 cut(s) 137, 164, 305, 332, 503
PspPPI RGGWCCY 1 cut(s) 305
RseI CAYNNNNRTG 2 cut(s) 56, 323
SaqAI TTAA 7 cut(s) 12, 201, 266, 372, 437, 543, 556
SatI GCNGC 3 cut(s) 192, 360, 531
Sau3AI GATC 1 cut(s) 460
Sau96I GGNCC 5 cut(s) 137, 164, 305, 332, 503
SchI GAGTC 3 cut(s) 166, 281, 452
ScrFI CCNGG 5 cut(s) 132, 162, 302, 330, 501
SetI ASST 6 cut(s) 142, 159, 289, 310, 327, 460
SfcI CTRYAG 2 cut(s) 231, 402
SinI GGWCC 5 cut(s) 137, 164, 305, 332, 503
SmiMI CAYNNNNRTG 2 cut(s) 56, 323
SpeI ACTAGT 1 cut(s) 179
SphI GCATGC 1 cut(s) 61
Sse9I AATT 2 cut(s) 62, 553
SspMI CTAG 3 cut(s) 180, 348, 519
StyD4I CCNGG 5 cut(s) 130, 160, 300, 328, 499
TaaI ACNGT 1 cut(s) 403
TaiI ACGT 2 cut(s) 159, 327
TaqI TCGA 3 cut(s) 242, 275, 446
TasI AATT 2 cut(s) 62, 553
Tru1I TTAA 7 cut(s) 12, 201, 266, 372, 437, 543, 556
Tru9I TTAA 7 cut(s) 12, 201, 266, 372, 437, 543, 556
TscAI CASTG 1 cut(s) 406
TseFI GTSAC 1 cut(s) 146
TseI GCWGC 3 cut(s) 191, 359, 530
Tsp45I GTSAC 1 cut(s) 146
TspDTI ATGAA 1 cut(s) 40
TspRI CASTG 1 cut(s) 406
VpaK11BI GGWCC 5 cut(s) 137, 164, 305, 332, 503
XceI RCATGY 1 cut(s) 61
XspI CTAG 3 cut(s) 180, 348, 519
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.