Rh6BG153800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Reverse (-)
24919852 .. 24920697
846 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG153800.1

Sequence Viewer

Length: 576 bp
ATGGGTGTTCTTAATGTTATTGGAGTTACAGCAGTTCTACTGCTATTTTTCATAAGCATGCACTTGTCCGAGGCTGGCAGGATGTTGCATGACGAGGAAGAAAACTCGACGACGAACAAACTTTTCGTTTTAACGGAGTCGAAGCAGAAGGGTGCTCCCCCTCCCGATGGTACTAATCCGCACACCAACAAGCCTGGTCCTACGACTCCTCCTAGTGGTCATGCTGCTTCAACCATTAACCAAAGAAACTTTGCAGGCCACACTACTATAGAAAACTCGACGACGAACAAACTTTTTGTTTTAATGGAGTCAAAGCAGAAGGCTGTTCATCCCCCTCCCGGTGGTCATAATGAGCAAACCGGCAAGCCTGGTCCTGCGACTCCTACTAGTGGTCATGCTGCTTCAACCATTAACCAAAGAAACTTTGCAGGCCACACTACTATAGAAAACTCGACGACGAACAAAATTTTCGTTTTAACGGAGTCGAAGCAGAAGGGTATTCCCCCTCCCGATGGTTCTAATGGGCACACCAACAAGCCTGGTCCTACGACTCCTACTAGTGGTCATGCTGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

191

Amino Acids

20.06

Weight (kDa)

8.97

Isoelectric Point (pI)

34.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 179
AcsI RAATTY 1 cut(s) 465
AfaI GTAC 1 cut(s) 172
AfiI CCNNNNNNNGG 7 cut(s) 167, 215, 338, 341, 389, 512, 560
AgsI TTSAA 2 cut(s) 231, 405
AhlI ACTAGT 2 cut(s) 386, 557
AjnI CCWGG 3 cut(s) 193, 367, 538
Alw21I GWGCWC 1 cut(s) 157
AoxI GGCC 2 cut(s) 256, 430
ApeKI GCWGC 3 cut(s) 224, 398, 569
ApoI RAATTY 1 cut(s) 465
AspS9I GGNCC 3 cut(s) 197, 371, 542
AsuC2I CCSGG 1 cut(s) 339
AvaII GGWCC 3 cut(s) 197, 371, 542
BaeGI GKGCMC 1 cut(s) 528
Bbv12I GWGCWC 1 cut(s) 157
BbvI GCAGC 3 cut(s) 211, 385, 556
BccI CCATC 2 cut(s) 161, 506
BciT130I CCWGG 3 cut(s) 195, 369, 540
BcnI CCSGG 1 cut(s) 339
BcuI ACTAGT 2 cut(s) 386, 557
BfaI CTAG 3 cut(s) 213, 387, 558
BfmI CTRYAG 2 cut(s) 267, 441
BisI GCNGC 3 cut(s) 225, 399, 570
BlsI GCNGC 3 cut(s) 226, 400, 571
Bme1390I CCNGG 4 cut(s) 195, 339, 369, 540
Bme18I GGWCC 3 cut(s) 197, 371, 542
BmgT120I GGNCC 3 cut(s) 197, 371, 542
BmrFI CCNGG 4 cut(s) 195, 339, 369, 540
BpuMI CCSGG 1 cut(s) 339
BsaJI CCNNGG 1 cut(s) 69
BsaXI ACNNNNNCTCC 2 cut(s) 193, 223
Bsc4I CCNNNNNNNGG 7 cut(s) 167, 215, 338, 341, 389, 512, 560
Bse118I RCCGGY 1 cut(s) 359
BseBI CCWGG 3 cut(s) 195, 369, 540
BseDI CCNNGG 1 cut(s) 69
BseGI GGATG 2 cut(s) 87, 328
BseLI CCNNNNNNNGG 7 cut(s) 167, 215, 338, 341, 389, 512, 560
BseRI GAGGAG 1 cut(s) 198
BseSI GKGCMC 1 cut(s) 528
BseXI GCAGC 3 cut(s) 211, 385, 556
BshFI GGCC 2 cut(s) 258, 432
BsiHKAI GWGCWC 1 cut(s) 157
BsiSI CCGG 2 cut(s) 339, 360
BslI CCNNNNNNNGG 7 cut(s) 167, 215, 338, 341, 389, 512, 560
BsnI GGCC 2 cut(s) 258, 432
Bsp1286I GDGCHC 2 cut(s) 157, 528
BspACI CCGC 1 cut(s) 179
BspANI GGCC 2 cut(s) 258, 432
BsrFI RCCGGY 1 cut(s) 359
BssAI RCCGGY 1 cut(s) 359
BssECI CCNNGG 1 cut(s) 69
Bst2UI CCWGG 3 cut(s) 195, 369, 540
BstC8I GCNNGC 5 cut(s) 59, 76, 256, 365, 430
BstF5I GGATG 2 cut(s) 87, 328
BstNI CCWGG 3 cut(s) 195, 369, 540
BstNSI RCATGY 1 cut(s) 61
BstSCI CCNGG 4 cut(s) 193, 337, 367, 538
BstSFI CTRYAG 2 cut(s) 267, 441
BstSLI GKGCMC 1 cut(s) 528
BstV1I GCAGC 3 cut(s) 211, 385, 556
BsuRI GGCC 2 cut(s) 258, 432
BtsCI GGATG 2 cut(s) 87, 328
Cac8I GCNNGC 5 cut(s) 59, 76, 256, 365, 430
Cfr10I RCCGGY 1 cut(s) 359
Cfr13I GGNCC 3 cut(s) 197, 371, 542
Csp6I GTAC 1 cut(s) 171
CviAII CATG 5 cut(s) 58, 89, 221, 395, 566
CviJI RGCY 7 cut(s) 74, 193, 258, 323, 367, 432, 538
CviKI_1 RGCY 7 cut(s) 74, 193, 258, 323, 367, 432, 538
CviQI GTAC 1 cut(s) 171
Eco47I GGWCC 3 cut(s) 197, 371, 542
EcoRII CCWGG 3 cut(s) 193, 367, 538
FaeI CATG 5 cut(s) 61, 92, 224, 398, 569
FaiI YATR 9 cut(s) 53, 59, 90, 222, 269, 348, 396, 443, 567
FatI CATG 5 cut(s) 57, 88, 220, 394, 565
Fnu4HI GCNGC 3 cut(s) 225, 399, 570
FokI GGATG 2 cut(s) 94, 315
Fsp4HI GCNGC 3 cut(s) 225, 399, 570
FspBI CTAG 3 cut(s) 213, 387, 558
GluI GCNGC 3 cut(s) 225, 399, 570
HaeIII GGCC 2 cut(s) 258, 432
HapII CCGG 2 cut(s) 339, 360
Hin1II CATG 5 cut(s) 61, 92, 224, 398, 569
HinfI GANTC 6 cut(s) 137, 205, 308, 379, 482, 550
HpaII CCGG 2 cut(s) 339, 360
Hpy188I TCNGA 1 cut(s) 70
Hpy188III TCNNGA 2 cut(s) 164, 509
Hpy99I CGWCG 6 cut(s) 112, 115, 283, 286, 457, 460
HpyAV CCTTC 3 cut(s) 142, 313, 487
HpyCH4V TGCA 4 cut(s) 61, 88, 254, 428
Hsp92II CATG 5 cut(s) 61, 92, 224, 398, 569
LmnI GCTCC 1 cut(s) 160
Lsp1109I GCAGC 3 cut(s) 211, 385, 556
MaeI CTAG 3 cut(s) 213, 387, 558
MaeIII GTNAC 1 cut(s) 25
MboII GAAGA 1 cut(s) 110
MhlI GDGCHC 2 cut(s) 157, 528
MluCI AATT 1 cut(s) 465
MlyI GAGTC 6 cut(s) 146, 199, 317, 373, 491, 544
MnlI CCTC 6 cut(s) 64, 88, 171, 219, 345, 516
MseI TTAA 7 cut(s) 12, 131, 237, 302, 411, 476, 574
MslI CAYNNNNRTG 1 cut(s) 56
MspI CCGG 2 cut(s) 339, 360
MspR9I CCNGG 4 cut(s) 195, 339, 369, 540
MvaI CCWGG 3 cut(s) 195, 369, 540
NciI CCSGG 1 cut(s) 339
NlaIII CATG 5 cut(s) 61, 92, 224, 398, 569
NspI RCATGY 1 cut(s) 61
PaeI GCATGC 1 cut(s) 61
PkrI GCNGC 3 cut(s) 226, 400, 571
PleI GAGTC 6 cut(s) 145, 199, 316, 373, 490, 544
PpsI GAGTC 6 cut(s) 145, 199, 316, 373, 490, 544
Psp6I CCWGG 3 cut(s) 193, 367, 538
PspGI CCWGG 3 cut(s) 193, 367, 538
PspPI GGNCC 3 cut(s) 197, 371, 542
RsaI GTAC 1 cut(s) 172
RsaNI GTAC 1 cut(s) 171
RseI CAYNNNNRTG 1 cut(s) 56
SaqAI TTAA 7 cut(s) 12, 131, 237, 302, 411, 476, 574
SatI GCNGC 3 cut(s) 225, 399, 570
Sau96I GGNCC 3 cut(s) 197, 371, 542
SchI GAGTC 6 cut(s) 146, 199, 317, 373, 491, 544
ScrFI CCNGG 4 cut(s) 195, 339, 369, 540
SduI GDGCHC 2 cut(s) 157, 528
SfcI CTRYAG 2 cut(s) 267, 441
SinI GGWCC 3 cut(s) 197, 371, 542
SmiMI CAYNNNNRTG 1 cut(s) 56
SpeI ACTAGT 2 cut(s) 386, 557
SphI GCATGC 1 cut(s) 61
Sse9I AATT 1 cut(s) 465
SsiI CCGC 1 cut(s) 179
SspMI CTAG 3 cut(s) 213, 387, 558
StyD4I CCNGG 4 cut(s) 193, 337, 367, 538
TaqI TCGA 5 cut(s) 107, 140, 278, 452, 485
TasI AATT 1 cut(s) 465
Tru1I TTAA 7 cut(s) 12, 131, 237, 302, 411, 476, 574
Tru9I TTAA 7 cut(s) 12, 131, 237, 302, 411, 476, 574
TseI GCWGC 3 cut(s) 224, 398, 569
TspDTI ATGAA 2 cut(s) 40, 317
TspGWI ACGGA 2 cut(s) 149, 494
VpaK11BI GGWCC 3 cut(s) 197, 371, 542
XapI RAATTY 1 cut(s) 465
XceI RCATGY 1 cut(s) 61
XspI CTAG 3 cut(s) 213, 387, 558
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.