Rh5AG111800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Forward (+)
10306640 .. 10307026
387 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG111800.1

Sequence Viewer

Length: 387 bp
ATGGGTGTTCTTAATGTTATCGGAGCTACAGCAGTTCTACTGCTATTTTTCATAAGCATGCAATTGTCTGAGGCTGGCAGGGTGTTGCATGACGAGGACGAAAACTTGACGAAGAAGGCTGTTCTTCCTCCCGGTGGACCTAATCCTACCACCAACGTGCCTGGTCCTGCGACTCCTACTAGCGGTCATACTGCAACCATTAACCAAAGAAACTTTGCAGGCCACACCACTACAGAAAACTTGACGAAGAACAAACATTTCGTTTTAATGGAGTCGAAGCAGAAAGGTGGTCAGCCTCCCCAGGGACCTAATCCTCCCACCAACGTGCCTGGTCCTGCGACTCCTACTAGCGGTCATGCTGCTTCAACCATTAACCAAAGAAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

128

Amino Acids

13.36

Weight (kDa)

9.3

Isoelectric Point (pI)

29.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 183, 351
AfiI CCNNNNNNNGG 4 cut(s) 134, 182, 302, 350
AgsI TTSAA 1 cut(s) 366
AjnI CCWGG 3 cut(s) 160, 300, 328
AleI CACNNNNGTG 2 cut(s) 155, 323
AluBI AGCT 1 cut(s) 26
AluI AGCT 1 cut(s) 26
AoxI GGCC 1 cut(s) 220
ApeKI GCWGC 1 cut(s) 359
AspS9I GGNCC 4 cut(s) 137, 164, 305, 332
AsuC2I CCSGG 1 cut(s) 132
AvaII GGWCC 4 cut(s) 137, 164, 305, 332
BbvI GCAGC 1 cut(s) 346
BciT130I CCWGG 3 cut(s) 162, 302, 330
BcnI CCSGG 1 cut(s) 132
BfaI CTAG 2 cut(s) 180, 348
BfmI CTRYAG 2 cut(s) 27, 231
BisI GCNGC 1 cut(s) 360
BlsI GCNGC 1 cut(s) 361
Bme1390I CCNGG 4 cut(s) 132, 162, 302, 330
Bme18I GGWCC 4 cut(s) 137, 164, 305, 332
BmgT120I GGNCC 4 cut(s) 137, 164, 305, 332
BmiI GGNNCC 1 cut(s) 306
BmrFI CCNGG 4 cut(s) 132, 162, 302, 330
BpuMI CCSGG 1 cut(s) 132
BsaJI CCNNGG 2 cut(s) 300, 301
Bsc4I CCNNNNNNNGG 4 cut(s) 134, 182, 302, 350
BseBI CCWGG 3 cut(s) 162, 302, 330
BseDI CCNNGG 2 cut(s) 300, 301
BseLI CCNNNNNNNGG 4 cut(s) 134, 182, 302, 350
BseMII CTCAG 1 cut(s) 60
BseXI GCAGC 1 cut(s) 346
BshFI GGCC 1 cut(s) 222
BsiSI CCGG 1 cut(s) 132
BslFI GGGAC 1 cut(s) 318
BslI CCNNNNNNNGG 4 cut(s) 134, 182, 302, 350
BsmFI GGGAC 1 cut(s) 318
BsnI GGCC 1 cut(s) 222
BspACI CCGC 2 cut(s) 183, 351
BspANI GGCC 1 cut(s) 222
BspCNI CTCAG 1 cut(s) 61
BspLI GGNNCC 1 cut(s) 306
BssECI CCNNGG 2 cut(s) 300, 301
Bst2UI CCWGG 3 cut(s) 162, 302, 330
BstC8I GCNNGC 3 cut(s) 59, 76, 220
BstDEI CTNAG 1 cut(s) 69
BstNI CCWGG 3 cut(s) 162, 302, 330
BstNSI RCATGY 1 cut(s) 61
BstSCI CCNGG 4 cut(s) 130, 160, 300, 328
BstSFI CTRYAG 2 cut(s) 27, 231
BstV1I GCAGC 1 cut(s) 346
BsuRI GGCC 1 cut(s) 222
Cac8I GCNNGC 3 cut(s) 59, 76, 220
Cfr13I GGNCC 4 cut(s) 137, 164, 305, 332
CviAII CATG 3 cut(s) 58, 89, 356
CviJI RGCY 5 cut(s) 26, 74, 119, 222, 295
CviKI_1 RGCY 5 cut(s) 26, 74, 119, 222, 295
DdeI CTNAG 1 cut(s) 69
Eco47I GGWCC 4 cut(s) 137, 164, 305, 332
EcoO109I RGGNCCY 1 cut(s) 305
EcoRII CCWGG 3 cut(s) 160, 300, 328
FaeI CATG 3 cut(s) 61, 92, 359
FaiI YATR 5 cut(s) 53, 59, 90, 189, 357
FaqI GGGAC 1 cut(s) 318
FatI CATG 3 cut(s) 57, 88, 355
Fnu4HI GCNGC 1 cut(s) 360
Fsp4HI GCNGC 1 cut(s) 360
FspBI CTAG 2 cut(s) 180, 348
GluI GCNGC 1 cut(s) 360
HaeIII GGCC 1 cut(s) 222
HapII CCGG 1 cut(s) 132
Hin1II CATG 3 cut(s) 61, 92, 359
HinfI GANTC 3 cut(s) 172, 272, 340
HpaII CCGG 1 cut(s) 132
Hpy166II GTNNAC 1 cut(s) 137
Hpy188I TCNGA 2 cut(s) 23, 70
Hpy8I GTNNAC 1 cut(s) 137
HpyAV CCTTC 1 cut(s) 109
HpyCH4IV ACGT 2 cut(s) 156, 324
HpyCH4V TGCA 4 cut(s) 61, 88, 194, 218
HpyF3I CTNAG 1 cut(s) 69
HpySE526I ACGT 2 cut(s) 156, 324
Hsp92II CATG 3 cut(s) 61, 92, 359
LmnI GCTCC 1 cut(s) 23
Lsp1109I GCAGC 1 cut(s) 346
MaeI CTAG 2 cut(s) 180, 348
MaeII ACGT 2 cut(s) 156, 324
MboII GAAGA 3 cut(s) 116, 124, 259
MfeI CAATTG 1 cut(s) 62
MluCI AATT 2 cut(s) 62, 382
MlyI GAGTC 3 cut(s) 166, 281, 334
MnlI CCTC 5 cut(s) 64, 88, 138, 306, 324
MseI TTAA 5 cut(s) 12, 201, 266, 372, 385
MslI CAYNNNNRTG 3 cut(s) 56, 155, 323
MspI CCGG 1 cut(s) 132
MspR9I CCNGG 4 cut(s) 132, 162, 302, 330
MunI CAATTG 1 cut(s) 62
MvaI CCWGG 3 cut(s) 162, 302, 330
NciI CCSGG 1 cut(s) 132
NlaIII CATG 3 cut(s) 61, 92, 359
NlaIV GGNNCC 1 cut(s) 306
NspI RCATGY 1 cut(s) 61
OliI CACNNNNGTG 2 cut(s) 155, 323
PaeI GCATGC 1 cut(s) 61
PasI CCCWGGG 1 cut(s) 301
PkrI GCNGC 1 cut(s) 361
PleI GAGTC 3 cut(s) 166, 280, 334
PpsI GAGTC 3 cut(s) 166, 280, 334
PpuMI RGGWCCY 1 cut(s) 305
Psp5II RGGWCCY 1 cut(s) 305
Psp6I CCWGG 3 cut(s) 160, 300, 328
PspGI CCWGG 3 cut(s) 160, 300, 328
PspN4I GGNNCC 1 cut(s) 306
PspPI GGNCC 4 cut(s) 137, 164, 305, 332
PspPPI RGGWCCY 1 cut(s) 305
RseI CAYNNNNRTG 3 cut(s) 56, 155, 323
SaqAI TTAA 5 cut(s) 12, 201, 266, 372, 385
SatI GCNGC 1 cut(s) 360
Sau96I GGNCC 4 cut(s) 137, 164, 305, 332
SchI GAGTC 3 cut(s) 166, 281, 334
ScrFI CCNGG 4 cut(s) 132, 162, 302, 330
SetI ASST 6 cut(s) 28, 142, 159, 289, 310, 327
SfcI CTRYAG 2 cut(s) 27, 231
SinI GGWCC 4 cut(s) 137, 164, 305, 332
SmiMI CAYNNNNRTG 3 cut(s) 56, 155, 323
SphI GCATGC 1 cut(s) 61
Sse9I AATT 2 cut(s) 62, 382
SsiI CCGC 2 cut(s) 183, 351
SspMI CTAG 2 cut(s) 180, 348
StyD4I CCNGG 4 cut(s) 130, 160, 300, 328
TaiI ACGT 2 cut(s) 159, 327
TaqI TCGA 1 cut(s) 275
TasI AATT 2 cut(s) 62, 382
Tru1I TTAA 5 cut(s) 12, 201, 266, 372, 385
Tru9I TTAA 5 cut(s) 12, 201, 266, 372, 385
TseI GCWGC 1 cut(s) 359
TspDTI ATGAA 1 cut(s) 40
VpaK11BI GGWCC 4 cut(s) 137, 164, 305, 332
XceI RCATGY 1 cut(s) 61
XspI CTAG 2 cut(s) 180, 348
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.