Rh4AG222000

Vesicle-fusing

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr4A
Physical Location & Seq
Forward (+)
52099052 .. 52100662
1611 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh4AG222000.1

Sequence Viewer

Length: 309 bp
ATGCAAGACTTAATGGCATGGTGGATTGTGGGGAGCAACATAAGCATATCTATCAAAGGGCTATCCTACTTGTGGAGCAAGTTAAAATCAAGTGACAGAAGCCCGCTTGTTACATGTCTTCTGGAAGGTCCTATTGGCAGTGGTAAATCTTCACAAGCACTTACTGTTGGCATCGACAGTGATTTCCCCTATGTTAAGATTGTTTTTGAAGATGCATACAAGTCACCATTGAGCATTATTATCCTGGAGTATATTGAAAGGGGAAAAAGCTTCTCGGTTTTGGTACAACAAGTGAATTGGGCTTCTTAG

Protein Analysis

102

Amino Acids

11.3

Weight (kDa)

6.14

Isoelectric Point (pI)

36.47

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 104
AfaI GTAC 1 cut(s) 285
AfiI CCNNNNNNNGG 1 cut(s) 72
AflIII ACRYGT 1 cut(s) 113
AgsI TTSAA 2 cut(s) 209, 257
AjnI CCWGG 1 cut(s) 243
AjuI GAANNNNNNNTTGG 2 cut(s) 117, 149
AluBI AGCT 1 cut(s) 270
AluI AGCT 1 cut(s) 270
AspS9I GGNCC 1 cut(s) 128
AsuHPI GGTGA 1 cut(s) 216
AvaII GGWCC 1 cut(s) 128
BbsI GAAGAC 1 cut(s) 110
BciT130I CCWGG 1 cut(s) 245
Bme1390I CCNGG 1 cut(s) 245
Bme18I GGWCC 1 cut(s) 128
BmgT120I GGNCC 1 cut(s) 128
BmrFI CCNGG 1 cut(s) 245
BmsI GCATC 2 cut(s) 180, 202
BpiI GAAGAC 1 cut(s) 110
BpmI CTGGAG 1 cut(s) 266
Bsc4I CCNNNNNNNGG 1 cut(s) 72
BseBI CCWGG 1 cut(s) 245
BseLI CCNNNNNNNGG 1 cut(s) 72
BslI CCNNNNNNNGG 1 cut(s) 72
BspACI CCGC 1 cut(s) 104
Bst2UI CCWGG 1 cut(s) 245
Bst4CI ACNGT 2 cut(s) 166, 179
BstC8I GCNNGC 1 cut(s) 104
BstDEI CTNAG 1 cut(s) 306
BstMWI GCNNNNNNNGC 1 cut(s) 42
BstNI CCWGG 1 cut(s) 245
BstNSI RCATGY 1 cut(s) 117
BstSCI CCNGG 1 cut(s) 243
BstV2I GAAGAC 1 cut(s) 110
BtsI GCAGTG 1 cut(s) 145
BtsIMutI CAGTG 2 cut(s) 145, 184
Cac8I GCNNGC 1 cut(s) 104
Cfr13I GGNCC 1 cut(s) 128
Csp6I GTAC 1 cut(s) 284
CviAII CATG 2 cut(s) 18, 114
CviJI RGCY 4 cut(s) 61, 102, 270, 302
CviKI_1 RGCY 4 cut(s) 61, 102, 270, 302
CviQI GTAC 1 cut(s) 284
DdeI CTNAG 1 cut(s) 306
Eco47I GGWCC 1 cut(s) 128
EcoO109I RGGNCCY 1 cut(s) 128
EcoRII CCWGG 1 cut(s) 243
EcoT22I ATGCAT 1 cut(s) 217
FaeI CATG 2 cut(s) 21, 117
FaiI YATR 7 cut(s) 19, 41, 47, 115, 192, 217, 252
FatI CATG 2 cut(s) 17, 113
FauI CCCGC 1 cut(s) 111
GsuI CTGGAG 1 cut(s) 266
Hin1II CATG 2 cut(s) 21, 117
HindIII AAGCTT 1 cut(s) 268
HphI GGTGA 1 cut(s) 216
Hpy188III TCNNGA 1 cut(s) 122
HpyAV CCTTC 1 cut(s) 119
HpyCH4III ACNGT 2 cut(s) 166, 179
HpyCH4V TGCA 2 cut(s) 4, 215
HpyF10VI GCNNNNNNNGC 1 cut(s) 42
HpyF3I CTNAG 1 cut(s) 306
Hsp92II CATG 2 cut(s) 21, 117
LmnI GCTCC 2 cut(s) 33, 75
LpnPI CCDG 3 cut(s) 107, 230, 257
LweI GCATC 2 cut(s) 180, 202
MaeIII GTNAC 3 cut(s) 92, 109, 222
MboII GAAGA 3 cut(s) 110, 141, 221
MluCI AATT 1 cut(s) 295
Mph1103I ATGCAT 1 cut(s) 217
MseI TTAA 3 cut(s) 11, 83, 195
MspR9I CCNGG 1 cut(s) 245
MvaI CCWGG 1 cut(s) 245
MwoI GCNNNNNNNGC 1 cut(s) 42
NlaIII CATG 2 cut(s) 21, 117
NmuCI GTSAC 2 cut(s) 92, 222
NsiI ATGCAT 1 cut(s) 217
NspI RCATGY 1 cut(s) 117
PciI ACATGT 1 cut(s) 113
PfoI TCCNGGA 1 cut(s) 243
PpuMI RGGWCCY 1 cut(s) 128
PscI ACATGT 1 cut(s) 113
Psp5II RGGWCCY 1 cut(s) 128
Psp6I CCWGG 1 cut(s) 243
PspGI CCWGG 1 cut(s) 243
PspPI GGNCC 1 cut(s) 128
PspPPI RGGWCCY 1 cut(s) 128
RsaI GTAC 1 cut(s) 285
RsaNI GTAC 1 cut(s) 284
SaqAI TTAA 3 cut(s) 11, 83, 195
Sau96I GGNCC 1 cut(s) 128
ScrFI CCNGG 1 cut(s) 245
SetI ASST 2 cut(s) 130, 272
SfaNI GCATC 2 cut(s) 180, 202
SinI GGWCC 1 cut(s) 128
Sse9I AATT 1 cut(s) 295
SsiI CCGC 1 cut(s) 104
StyD4I CCNGG 1 cut(s) 243
TaaI ACNGT 2 cut(s) 166, 179
TaqI TCGA 1 cut(s) 174
TasI AATT 1 cut(s) 295
Tru1I TTAA 3 cut(s) 11, 83, 195
Tru9I TTAA 3 cut(s) 11, 83, 195
TscAI CASTG 2 cut(s) 145, 184
TseFI GTSAC 2 cut(s) 92, 222
Tsp45I GTSAC 2 cut(s) 92, 222
TspRI CASTG 2 cut(s) 145, 184
VpaK11BI GGWCC 1 cut(s) 128
XceI RCATGY 1 cut(s) 117
Zsp2I ATGCAT 1 cut(s) 217
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.