Rh5BG286400

Serine threonine-protein phosphatase 4 regulatory subunit

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Reverse (-)
36444938 .. 36450353
5416 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG286400.1

Sequence Viewer

Length: 180 bp
ATGAAGGTTCTGTCAGAGTATCCTGATGCAGAAAAGACTATTGATAAGCAAAATACTACTTTAGGAGAAACCTACCTAGAACTGGTCGGTGAAGAGATCCTATTATCCACGCGCAGCATCTACCCGAATCTCTCAAAGCTTGCTCTAGCTCTAGAAAAGGATTCTAAGCTAAATGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

59

Amino Acids

6.63

Weight (kDa)

4.73

Isoelectric Point (pI)

31.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 112
AclWI GGATC 1 cut(s) 91
AfiI CCNNNNNNNGG 1 cut(s) 82
AluBI AGCT 3 cut(s) 139, 149, 169
AluI AGCT 3 cut(s) 139, 149, 169
AlwI GGATC 1 cut(s) 91
ApeKI GCWGC 1 cut(s) 114
AspLEI GCGC 1 cut(s) 114
AsuHPI GGTGA 1 cut(s) 101
BbvI GCAGC 1 cut(s) 126
BciVI GTATCC 1 cut(s) 30
BfaI CTAG 3 cut(s) 77, 146, 152
BfuI GTATCC 1 cut(s) 30
BisI GCNGC 1 cut(s) 115
BlsI GCNGC 1 cut(s) 116
BmsI GCATC 2 cut(s) 16, 126
Bsc4I CCNNNNNNNGG 1 cut(s) 82
Bse1I ACTGG 1 cut(s) 87
BseLI CCNNNNNNNGG 1 cut(s) 82
BseNI ACTGG 1 cut(s) 87
BseXI GCAGC 1 cut(s) 126
Bsh1236I CGCG 1 cut(s) 112
BslI CCNNNNNNNGG 1 cut(s) 82
Bsp143I GATC 1 cut(s) 96
BspFNI CGCG 1 cut(s) 112
BspPI GGATC 1 cut(s) 91
BsrI ACTGG 1 cut(s) 87
BssMI GATC 1 cut(s) 96
Bst6I CTCTTC 1 cut(s) 87
BstC8I GCNNGC 1 cut(s) 141
BstDEI CTNAG 1 cut(s) 165
BstFNI CGCG 1 cut(s) 112
BstHHI GCGC 1 cut(s) 114
BstKTI GATC 1 cut(s) 99
BstMBI GATC 1 cut(s) 96
BstUI CGCG 1 cut(s) 112
BstV1I GCAGC 1 cut(s) 126
BstX2I RGATCY 1 cut(s) 96
BstYI RGATCY 1 cut(s) 96
BsuI GTATCC 1 cut(s) 30
Cac8I GCNNGC 1 cut(s) 141
CfoI GCGC 1 cut(s) 114
CviJI RGCY 3 cut(s) 139, 149, 169
CviKI_1 RGCY 3 cut(s) 139, 149, 169
DdeI CTNAG 1 cut(s) 165
DpnI GATC 1 cut(s) 98
DpnII GATC 1 cut(s) 96
Eam1104I CTCTTC 1 cut(s) 87
EarI CTCTTC 1 cut(s) 87
Fnu4HI GCNGC 1 cut(s) 115
Fsp4HI GCNGC 1 cut(s) 115
FspBI CTAG 3 cut(s) 77, 146, 152
GlaI GCGC 1 cut(s) 113
GluI GCNGC 1 cut(s) 115
HhaI GCGC 1 cut(s) 114
Hin6I GCGC 1 cut(s) 112
HinP1I GCGC 1 cut(s) 112
HindIII AAGCTT 1 cut(s) 137
HinfI GANTC 2 cut(s) 127, 161
HphI GGTGA 1 cut(s) 101
Hpy188I TCNGA 1 cut(s) 16
Hpy188III TCNNGA 2 cut(s) 23, 152
HpyCH4V TGCA 1 cut(s) 29
HpyF3I CTNAG 1 cut(s) 165
HspAI GCGC 1 cut(s) 112
Kzo9I GATC 1 cut(s) 96
LpnPI CCDG 2 cut(s) 36, 68
Lsp1109I GCAGC 1 cut(s) 126
LweI GCATC 2 cut(s) 16, 126
MaeI CTAG 3 cut(s) 77, 146, 152
MalI GATC 1 cut(s) 98
MboI GATC 1 cut(s) 96
MboII GAAGA 1 cut(s) 104
MflI RGATCY 1 cut(s) 96
MvnI CGCG 1 cut(s) 112
NdeII GATC 1 cut(s) 96
PfeI GAWTC 2 cut(s) 127, 161
PkrI GCNGC 1 cut(s) 116
PsuI RGATCY 1 cut(s) 96
SatI GCNGC 1 cut(s) 115
Sau3AI GATC 1 cut(s) 96
SetI ASST 6 cut(s) 9, 74, 78, 141, 151, 171
SfaNI GCATC 2 cut(s) 16, 126
SgeI CNNG 9 cut(s) 35, 89, 95, 121, 123, 136, 152, 158, 164
SspMI CTAG 3 cut(s) 77, 146, 152
TfiI GAWTC 2 cut(s) 127, 161
TseI GCWGC 1 cut(s) 114
TspDTI ATGAA 1 cut(s) 17
XbaI TCTAGA 1 cut(s) 151
XspI CTAG 3 cut(s) 77, 146, 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.