Rh5DG095200

proline--tRNA ligase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Forward (+)
8722011 .. 8722295
285 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG095200.1

Sequence Viewer

Length: 285 bp
ATGTTTGATGTTGCAAGGGAAAAACGAGATGCTTGTATCCAAGTTGCAAGGACATGGGAGGAATTTACGGAAGCTCTAAAGCAAAAGAAAATGATCTTGGCTCCTTGGTGTGACGAAAAGGATTTGGAAGAGGATGTGGAAAAACGAACCAAGGATGAAGGTGAAATGGGAGCAGCTAAGTCGCTCTGCACCCCATTTGAGCAGCCTGAACTTGCTGAAGGGACACTTTGCTTTGCCTCTGGAAAGCCAGCAAGGAAGTGGACCTATTGGGGAAGGACTTACTAG

Protein Analysis

94

Amino Acids

10.93

Weight (kDa)

5.08

Isoelectric Point (pI)

47.76

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ProRS-C_1 PF09180 19 - 94 4.5e-25 Prolyl-tRNA synthetase, C-terminal
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 62
AcuI CTGAAG 1 cut(s) 237
AjuI GAANNNNNNNTTGG 2 cut(s) 80, 112
AluBI AGCT 2 cut(s) 74, 176
AluI AGCT 2 cut(s) 74, 176
ApeKI GCWGC 2 cut(s) 173, 202
ApoI RAATTY 1 cut(s) 62
AspS9I GGNCC 1 cut(s) 261
AsuHPI GGTGA 1 cut(s) 173
AvaII GGWCC 1 cut(s) 261
BbvI GCAGC 2 cut(s) 185, 214
BcgI CGANNNNNNTGC 2 cut(s) 162, 196
BciVI GTATCC 1 cut(s) 47
BfaI CTAG 1 cut(s) 283
BfuI GTATCC 1 cut(s) 47
BisI GCNGC 2 cut(s) 174, 203
BlsI GCNGC 2 cut(s) 175, 204
Bme18I GGWCC 1 cut(s) 261
BmgT120I GGNCC 1 cut(s) 261
BmiI GGNNCC 1 cut(s) 102
BmsI GCATC 1 cut(s) 19
BsaJI CCNNGG 2 cut(s) 104, 150
BseDI CCNNGG 2 cut(s) 104, 150
BseGI GGATG 2 cut(s) 139, 160
BseXI GCAGC 2 cut(s) 185, 214
BsgI GTGCAG 1 cut(s) 172
BslFI GGGAC 1 cut(s) 235
BsmFI GGGAC 1 cut(s) 235
Bsp143I GATC 1 cut(s) 93
BspLI GGNNCC 1 cut(s) 102
BssECI CCNNGG 2 cut(s) 104, 150
BssMI GATC 1 cut(s) 93
BssT1I CCWWGG 2 cut(s) 104, 150
Bst6I CTCTTC 1 cut(s) 123
BstC8I GCNNGC 1 cut(s) 249
BstDEI CTNAG 1 cut(s) 177
BstF5I GGATG 2 cut(s) 139, 160
BstKTI GATC 1 cut(s) 96
BstMBI GATC 1 cut(s) 93
BstV1I GCAGC 2 cut(s) 185, 214
BsuI GTATCC 1 cut(s) 47
BtsCI GGATG 2 cut(s) 139, 160
Cac8I GCNNGC 1 cut(s) 249
Cfr13I GGNCC 1 cut(s) 261
CviAII CATG 1 cut(s) 54
CviJI RGCY 5 cut(s) 74, 101, 176, 205, 247
CviKI_1 RGCY 5 cut(s) 74, 101, 176, 205, 247
DdeI CTNAG 1 cut(s) 177
DpnI GATC 1 cut(s) 95
DpnII GATC 1 cut(s) 93
Eam1104I CTCTTC 1 cut(s) 123
EarI CTCTTC 1 cut(s) 123
Eco130I CCWWGG 2 cut(s) 104, 150
Eco47I GGWCC 1 cut(s) 261
Eco57I CTGAAG 1 cut(s) 237
EcoT14I CCWWGG 2 cut(s) 104, 150
ErhI CCWWGG 2 cut(s) 104, 150
FaeI CATG 1 cut(s) 57
FaiI YATR 1 cut(s) 55
FalI AAGNNNNNCTT 2 cut(s) 210, 242
FaqI GGGAC 1 cut(s) 235
FatI CATG 1 cut(s) 53
Fnu4HI GCNGC 2 cut(s) 174, 203
FokI GGATG 2 cut(s) 146, 167
Fsp4HI GCNGC 2 cut(s) 174, 203
FspBI CTAG 1 cut(s) 283
GluI GCNGC 2 cut(s) 174, 203
Hin1II CATG 1 cut(s) 57
HphI GGTGA 1 cut(s) 173
Hpy166II GTNNAC 1 cut(s) 261
Hpy188III TCNNGA 1 cut(s) 240
Hpy8I GTNNAC 1 cut(s) 261
HpyAV CCTTC 3 cut(s) 152, 212, 267
HpyCH4V TGCA 3 cut(s) 14, 47, 189
HpyF3I CTNAG 1 cut(s) 177
Hsp92II CATG 1 cut(s) 57
Kzo9I GATC 1 cut(s) 93
LmnI GCTCC 2 cut(s) 106, 170
LpnPI CCDG 3 cut(s) 219, 225, 261
Lsp1109I GCAGC 2 cut(s) 185, 214
LweI GCATC 1 cut(s) 19
MaeI CTAG 1 cut(s) 283
MaeIII GTNAC 1 cut(s) 110
MalI GATC 1 cut(s) 95
MboI GATC 1 cut(s) 93
MboII GAAGA 1 cut(s) 140
MluCI AATT 1 cut(s) 62
MnlI CCTC 3 cut(s) 52, 124, 247
NdeII GATC 1 cut(s) 93
NlaIII CATG 1 cut(s) 57
NlaIV GGNNCC 1 cut(s) 102
NmuCI GTSAC 1 cut(s) 110
PkrI GCNGC 2 cut(s) 175, 204
PspN4I GGNNCC 1 cut(s) 102
PspPI GGNCC 1 cut(s) 261
SatI GCNGC 2 cut(s) 174, 203
Sau3AI GATC 1 cut(s) 93
Sau96I GGNCC 1 cut(s) 261
SetI ASST 4 cut(s) 76, 163, 178, 266
SfaNI GCATC 1 cut(s) 19
SinI GGWCC 1 cut(s) 261
Sse9I AATT 1 cut(s) 62
SspMI CTAG 1 cut(s) 283
StyI CCWWGG 2 cut(s) 104, 150
TasI AATT 1 cut(s) 62
TseFI GTSAC 1 cut(s) 110
TseI GCWGC 2 cut(s) 173, 202
Tsp45I GTSAC 1 cut(s) 110
TspDTI ATGAA 1 cut(s) 171
TspGWI ACGGA 1 cut(s) 83
VpaK11BI GGWCC 1 cut(s) 261
XapI RAATTY 1 cut(s) 62
XcmI CCANNNNNNNNNTGG 1 cut(s) 255
XspI CTAG 1 cut(s) 283
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.