Rh7BG308700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Forward (+)
29717343 .. 29748095
30753 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG308700.1

Sequence Viewer

Length: 228 bp
ATGCCAGTTGACAAAGAGATGGAATTTGAATATGCTAAATTAAAGAATGGAGTCACAACTCAGGTAGTGGCCAGGGTCATCGATCCGCCAATGAGTGTTGTTGGTCAAGAGGCGGTCGTCAGGCCATTTGCTGTTTCTGCTTACCCTCTCTCCAAAACCCCCAACCTCTTCTCTCTCCGAACAACCACCTCCCAGCCATCAAAACCCAGAAATTTTACATGTTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

75

Amino Acids

8.29

Weight (kDa)

9.36

Isoelectric Point (pI)

34.45

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 86, 113
AclWI GGATC 1 cut(s) 77
AcoI YGGCCR 1 cut(s) 69
AcsI RAATTY 2 cut(s) 23, 211
AflIII ACRYGT 1 cut(s) 218
AgsI TTSAA 1 cut(s) 29
AjnI CCWGG 1 cut(s) 71
AlwI GGATC 1 cut(s) 77
AoxI GGCC 2 cut(s) 69, 122
ApoI RAATTY 2 cut(s) 23, 211
BalI TGGCCA 1 cut(s) 71
BccI CCATC 2 cut(s) 13, 205
BciT130I CCWGG 1 cut(s) 73
Bme1390I CCNGG 1 cut(s) 73
BmrFI CCNGG 1 cut(s) 73
Bsa29I ATCGAT 1 cut(s) 81
BsaJI CCNNGG 1 cut(s) 72
BsaXI ACNNNNNCTCC 2 cut(s) 134, 164
Bse1I ACTGG 1 cut(s) 5
BseBI CCWGG 1 cut(s) 73
BseCI ATCGAT 1 cut(s) 81
BseDI CCNNGG 1 cut(s) 72
BseMII CTCAG 1 cut(s) 74
BseNI ACTGG 1 cut(s) 5
BseYI CCCAGC 1 cut(s) 192
Bsh1285I CGRYCG 1 cut(s) 117
BshFI GGCC 2 cut(s) 71, 124
BshVI ATCGAT 1 cut(s) 81
BsiEI CGRYCG 1 cut(s) 117
BsnI GGCC 2 cut(s) 71, 124
Bsp143I GATC 1 cut(s) 82
BspACI CCGC 2 cut(s) 86, 113
BspANI GGCC 2 cut(s) 71, 124
BspCNI CTCAG 1 cut(s) 73
BspDI ATCGAT 1 cut(s) 81
BspPI GGATC 1 cut(s) 77
BsrI ACTGG 1 cut(s) 5
BssECI CCNNGG 1 cut(s) 72
BssMI GATC 1 cut(s) 82
Bst2UI CCWGG 1 cut(s) 73
Bst6I CTCTTC 1 cut(s) 173
BstDEI CTNAG 1 cut(s) 60
BstKTI GATC 1 cut(s) 85
BstMBI GATC 1 cut(s) 82
BstMCI CGRYCG 1 cut(s) 117
BstMWI GCNNNNNNNGC 1 cut(s) 137
BstNI CCWGG 1 cut(s) 73
BstNSI RCATGY 1 cut(s) 222
BstSCI CCNGG 1 cut(s) 71
Bsu15I ATCGAT 1 cut(s) 81
BsuRI GGCC 2 cut(s) 71, 124
BsuTUI ATCGAT 1 cut(s) 81
ClaI ATCGAT 1 cut(s) 81
CviAII CATG 1 cut(s) 219
CviJI RGCY 3 cut(s) 71, 124, 196
CviKI_1 RGCY 3 cut(s) 71, 124, 196
DdeI CTNAG 1 cut(s) 60
DpnI GATC 1 cut(s) 84
DpnII GATC 1 cut(s) 82
EaeI YGGCCR 1 cut(s) 69
Eam1104I CTCTTC 1 cut(s) 173
EarI CTCTTC 1 cut(s) 173
EciI GGCGGA 1 cut(s) 75
EcoRII CCWGG 1 cut(s) 71
FaeI CATG 1 cut(s) 222
FaiI YATR 2 cut(s) 33, 220
FatI CATG 1 cut(s) 218
GsaI CCCAGC 1 cut(s) 196
HaeIII GGCC 2 cut(s) 71, 124
Hin1II CATG 1 cut(s) 222
HincII GTYRAC 1 cut(s) 10
HindII GTYRAC 1 cut(s) 10
HinfI GANTC 1 cut(s) 51
Hpy166II GTNNAC 1 cut(s) 10
Hpy188I TCNGA 1 cut(s) 179
Hpy188III TCNNGA 2 cut(s) 107, 225
Hpy8I GTNNAC 1 cut(s) 10
HpyF10VI GCNNNNNNNGC 1 cut(s) 137
HpyF3I CTNAG 1 cut(s) 60
Hsp92II CATG 1 cut(s) 222
Kzo9I GATC 1 cut(s) 82
LpnPI CCDG 7 cut(s) 18, 47, 58, 85, 106, 206, 220
MaeIII GTNAC 1 cut(s) 52
MalI GATC 1 cut(s) 84
MboI GATC 1 cut(s) 82
MboII GAAGA 1 cut(s) 160
MlsI TGGCCA 1 cut(s) 71
MluCI AATT 3 cut(s) 23, 38, 211
MluNI TGGCCA 1 cut(s) 71
MlyI GAGTC 1 cut(s) 60
MnlI CCTC 4 cut(s) 103, 156, 176, 199
Mox20I TGGCCA 1 cut(s) 71
MscI TGGCCA 1 cut(s) 71
MseI TTAA 1 cut(s) 41
Msp20I TGGCCA 1 cut(s) 71
MspR9I CCNGG 1 cut(s) 73
MvaI CCWGG 1 cut(s) 73
MwoI GCNNNNNNNGC 1 cut(s) 137
NdeII GATC 1 cut(s) 82
NlaIII CATG 1 cut(s) 222
NmuCI GTSAC 1 cut(s) 52
NspI RCATGY 1 cut(s) 222
PciI ACATGT 1 cut(s) 218
PleI GAGTC 1 cut(s) 59
PpsI GAGTC 1 cut(s) 59
PscI ACATGT 1 cut(s) 218
Psp6I CCWGG 1 cut(s) 71
PspFI CCCAGC 1 cut(s) 192
PspGI CCWGG 1 cut(s) 71
SaqAI TTAA 1 cut(s) 41
Sau3AI GATC 1 cut(s) 82
SchI GAGTC 1 cut(s) 60
ScrFI CCNGG 1 cut(s) 73
SetI ASST 3 cut(s) 66, 168, 191
SgeI CNNG 8 cut(s) 17, 74, 84, 85, 119, 133, 205, 219
Sse9I AATT 3 cut(s) 23, 38, 211
SsiI CCGC 2 cut(s) 86, 113
StyD4I CCNGG 1 cut(s) 71
TaqI TCGA 1 cut(s) 81
TasI AATT 3 cut(s) 23, 38, 211
Tru1I TTAA 1 cut(s) 41
Tru9I TTAA 1 cut(s) 41
TseFI GTSAC 1 cut(s) 52
Tsp45I GTSAC 1 cut(s) 52
XapI RAATTY 2 cut(s) 23, 211
XceI RCATGY 1 cut(s) 222
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.