Rh7DG257300

Branched-chain-amino-acid aminotransferase-like protein 3

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7D
Physical Location & Seq
Reverse (-)
26934734 .. 26939520
4787 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7DG257300.1

Sequence Viewer

Length: 378 bp
ATGGATTCATTGGAGGTTGGAAATGTCGAGGATTTTAAGGTTCATGTGTTCAAATCATCATCTGAGTTGCTTGAAAAGCTTCATGAGAAGTGGAGCAAAGTAGGAAAGAAACCATACCCAGCCATGTATTCCAGCATTTATGGTGGAATCATTCTTGATCCAGCTTTGATGGTGATTCCAATAGACGATCACAGGATTGCTGATGAGAATCGCACCAGGCTACTTGTACTGCTCATATTGAAGCTTGATGCATCAGACTATCAGAGTTTGAAAATCTTTTGGGTAATCACATGGACTGAGGATGGAGCTGAGTCAAGAGCATATGTTCCAAGCGTCTGGACTTCATTAGAGTTATTGGGAAGAGGATGGGGCCAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

125

Amino Acids

14.27

Weight (kDa)

5.32

Isoelectric Point (pI)

23.12

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 152
AfaI GTAC 1 cut(s) 228
AgsI TTSAA 4 cut(s) 52, 74, 241, 271
AjnI CCWGG 1 cut(s) 215
AluBI AGCT 4 cut(s) 79, 164, 244, 308
AluI AGCT 4 cut(s) 79, 164, 244, 308
AlwI GGATC 1 cut(s) 152
AoxI GGCC 1 cut(s) 370
Asp700I GAANNNNTTC 1 cut(s) 78
AspS9I GGNCC 1 cut(s) 370
AsuHPI GGTGA 1 cut(s) 184
BccI CCATC 3 cut(s) 163, 296, 360
BciT130I CCWGG 1 cut(s) 217
Bme1390I CCNGG 1 cut(s) 217
BmgT120I GGNCC 1 cut(s) 370
BmiI GGNNCC 1 cut(s) 371
BmrFI CCNGG 1 cut(s) 217
BmsI GCATC 2 cut(s) 238, 260
BsaBI GATNNNNATC 1 cut(s) 207
Bse8I GATNNNNATC 1 cut(s) 207
BseBI CCWGG 1 cut(s) 217
BseGI GGATG 2 cut(s) 307, 371
BseJI GATNNNNATC 1 cut(s) 207
BseMII CTCAG 3 cut(s) 54, 288, 300
BseYI CCCAGC 1 cut(s) 118
BshFI GGCC 1 cut(s) 372
BsnI GGCC 1 cut(s) 372
Bsp143I GATC 2 cut(s) 157, 187
BspANI GGCC 1 cut(s) 372
BspCNI CTCAG 3 cut(s) 55, 289, 301
BspHI TCATGA 1 cut(s) 82
BspLI GGNNCC 1 cut(s) 371
BspPI GGATC 1 cut(s) 152
BssMI GATC 2 cut(s) 157, 187
Bst2UI CCWGG 1 cut(s) 217
Bst6I CTCTTC 1 cut(s) 355
BstDEI CTNAG 3 cut(s) 63, 297, 309
BstF5I GGATG 2 cut(s) 307, 371
BstKTI GATC 2 cut(s) 160, 190
BstMBI GATC 2 cut(s) 157, 187
BstMWI GCNNNNNNNGC 1 cut(s) 76
BstNI CCWGG 1 cut(s) 217
BstSCI CCNGG 1 cut(s) 215
BstXI CCANNNNNNTGG 1 cut(s) 336
BsuRI GGCC 1 cut(s) 372
BtsCI GGATG 2 cut(s) 307, 371
CciI TCATGA 1 cut(s) 82
Cfr13I GGNCC 1 cut(s) 370
CseI GACGC 1 cut(s) 322
Csp6I GTAC 1 cut(s) 227
CviAII CATG 4 cut(s) 44, 83, 124, 291
CviJI RGCY 7 cut(s) 79, 122, 164, 220, 244, 308, 372
CviKI_1 RGCY 7 cut(s) 79, 122, 164, 220, 244, 308, 372
CviQI GTAC 1 cut(s) 227
DdeI CTNAG 3 cut(s) 63, 297, 309
DpnI GATC 2 cut(s) 159, 189
DpnII GATC 2 cut(s) 157, 187
Eam1104I CTCTTC 1 cut(s) 355
EarI CTCTTC 1 cut(s) 355
EcoRII CCWGG 1 cut(s) 215
EcoT22I ATGCAT 1 cut(s) 253
FaeI CATG 4 cut(s) 47, 86, 127, 294
FaiI YATR 9 cut(s) 45, 84, 115, 125, 141, 236, 292, 322, 324
FatI CATG 4 cut(s) 43, 82, 123, 290
FauNDI CATATG 1 cut(s) 322
FokI GGATG 1 cut(s) 314
GsaI CCCAGC 1 cut(s) 122
HaeIII GGCC 1 cut(s) 372
HgaI GACGC 1 cut(s) 322
Hin1II CATG 4 cut(s) 47, 86, 127, 294
HindIII AAGCTT 2 cut(s) 77, 242
HinfI GANTC 5 cut(s) 5, 147, 175, 208, 311
HphI GGTGA 1 cut(s) 184
Hpy188I TCNGA 3 cut(s) 64, 256, 264
Hpy188III TCNNGA 4 cut(s) 83, 155, 315, 337
HpyCH4V TGCA 1 cut(s) 251
HpyF10VI GCNNNNNNNGC 1 cut(s) 76
HpyF3I CTNAG 3 cut(s) 63, 297, 309
Hsp92II CATG 4 cut(s) 47, 86, 127, 294
Kzo9I GATC 2 cut(s) 157, 187
LmnI GCTCC 2 cut(s) 93, 305
LpnPI CCDG 7 cut(s) 132, 145, 174, 178, 202, 229, 322
LweI GCATC 2 cut(s) 238, 260
MalI GATC 2 cut(s) 159, 189
MboI GATC 2 cut(s) 157, 187
MboII GAAGA 1 cut(s) 372
MlyI GAGTC 1 cut(s) 320
MnlI CCTC 4 cut(s) 7, 22, 292, 356
Mph1103I ATGCAT 1 cut(s) 253
MroXI GAANNNNTTC 1 cut(s) 78
MseI TTAA 1 cut(s) 36
MspR9I CCNGG 1 cut(s) 217
MvaI CCWGG 1 cut(s) 217
MwoI GCNNNNNNNGC 1 cut(s) 76
NdeI CATATG 1 cut(s) 322
NdeII GATC 2 cut(s) 157, 187
NlaIII CATG 4 cut(s) 47, 86, 127, 294
NlaIV GGNNCC 1 cut(s) 371
NsiI ATGCAT 1 cut(s) 253
PagI TCATGA 1 cut(s) 82
PdmI GAANNNNTTC 1 cut(s) 78
PfeI GAWTC 4 cut(s) 5, 147, 175, 208
PleI GAGTC 1 cut(s) 319
PpsI GAGTC 1 cut(s) 319
Psp6I CCWGG 1 cut(s) 215
PspFI CCCAGC 1 cut(s) 118
PspGI CCWGG 1 cut(s) 215
PspN4I GGNNCC 1 cut(s) 371
PspPI GGNCC 1 cut(s) 370
RsaI GTAC 1 cut(s) 228
RsaNI GTAC 1 cut(s) 227
SaqAI TTAA 1 cut(s) 36
Sau3AI GATC 2 cut(s) 157, 187
Sau96I GGNCC 1 cut(s) 370
SchI GAGTC 1 cut(s) 320
ScrFI CCNGG 1 cut(s) 217
SetI ASST 6 cut(s) 18, 42, 81, 166, 246, 310
SfaNI GCATC 2 cut(s) 238, 260
StyD4I CCNGG 1 cut(s) 215
TaqI TCGA 1 cut(s) 27
TatI WGTACW 1 cut(s) 226
TfiI GAWTC 4 cut(s) 5, 147, 175, 208
Tru1I TTAA 1 cut(s) 36
Tru9I TTAA 1 cut(s) 36
TspDTI ATGAA 3 cut(s) 32, 71, 333
XmnI GAANNNNTTC 1 cut(s) 78
Zsp2I ATGCAT 1 cut(s) 253
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.