Rw5G025470

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
OG0003489
Physical Location & Seq
Reverse (-)
36379958 .. 36398753
18796 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G025470.1

Sequence Viewer

Length: 159 bp
ATGGATGTTTATATGAGTTGTGTGTTAGCCTGGAGGGTTCGCGAAGCTCTGACTGAGCTAGATCTTTTAGCAGAGGTTCTTGAAGTTAGACGAGACTTGAAGATGACAACTAGAAAAATTGCATCTCAGTGTGAGTACCTTAAAATCTATGAAAATTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

52

Amino Acids

6.21

Weight (kDa)

5.25

Isoelectric Point (pI)

44.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 42
AfaI GTAC 1 cut(s) 137
AgsI TTSAA 2 cut(s) 83, 100
AjnI CCWGG 1 cut(s) 29
AluBI AGCT 2 cut(s) 47, 58
AluI AGCT 2 cut(s) 47, 58
Alw26I GTCTC 1 cut(s) 87
BciT130I CCWGG 1 cut(s) 31
BcoDI GTCTC 1 cut(s) 87
BfaI CTAG 2 cut(s) 59, 111
BglII AGATCT 1 cut(s) 61
Bme1390I CCNGG 1 cut(s) 31
BmrFI CCNGG 1 cut(s) 31
BmsI GCATC 1 cut(s) 131
BpmI CTGGAG 1 cut(s) 52
BseBI CCWGG 1 cut(s) 31
BseGI GGATG 1 cut(s) 10
BseMII CTCAG 2 cut(s) 45, 140
Bsh1236I CGCG 1 cut(s) 42
BsmAI GTCTC 1 cut(s) 87
Bsp143I GATC 1 cut(s) 61
Bsp68I TCGCGA 1 cut(s) 42
BspCNI CTCAG 2 cut(s) 46, 139
BspFNI CGCG 1 cut(s) 42
BssMI GATC 1 cut(s) 61
Bst2UI CCWGG 1 cut(s) 31
BstDEI CTNAG 2 cut(s) 54, 126
BstF5I GGATG 1 cut(s) 10
BstFNI CGCG 1 cut(s) 42
BstKTI GATC 1 cut(s) 64
BstMAI GTCTC 1 cut(s) 87
BstMBI GATC 1 cut(s) 61
BstNI CCWGG 1 cut(s) 31
BstSCI CCNGG 1 cut(s) 29
BstUI CGCG 1 cut(s) 42
BstX2I RGATCY 1 cut(s) 61
BstYI RGATCY 1 cut(s) 61
BtsCI GGATG 1 cut(s) 10
BtsIMutI CAGTG 1 cut(s) 134
BtuMI TCGCGA 1 cut(s) 42
Csp6I GTAC 1 cut(s) 136
CviJI RGCY 3 cut(s) 29, 47, 58
CviKI_1 RGCY 3 cut(s) 29, 47, 58
CviQI GTAC 1 cut(s) 136
DdeI CTNAG 2 cut(s) 54, 126
DpnI GATC 1 cut(s) 63
DpnII GATC 1 cut(s) 61
EcoRII CCWGG 1 cut(s) 29
FaiI YATR 3 cut(s) 12, 14, 150
FokI GGATG 1 cut(s) 17
FspBI CTAG 2 cut(s) 59, 111
FspEI CC 6 cut(s) 16, 19, 20, 43, 59, 152
GsuI CTGGAG 1 cut(s) 52
Hpy188I TCNGA 1 cut(s) 51
Hpy188III TCNNGA 2 cut(s) 41, 80
HpyCH4V TGCA 1 cut(s) 122
HpyF3I CTNAG 2 cut(s) 54, 126
Kzo9I GATC 1 cut(s) 61
LpnPI CCDG 2 cut(s) 16, 43
LweI GCATC 1 cut(s) 131
MaeI CTAG 2 cut(s) 59, 111
MalI GATC 1 cut(s) 63
MboI GATC 1 cut(s) 61
MboII GAAGA 1 cut(s) 112
MflI RGATCY 1 cut(s) 61
MluCI AATT 2 cut(s) 117, 154
MnlI CCTC 2 cut(s) 27, 67
MseI TTAA 1 cut(s) 141
MslI CAYNNNNRTG 1 cut(s) 127
MspR9I CCNGG 1 cut(s) 31
MvaI CCWGG 1 cut(s) 31
MvnI CGCG 1 cut(s) 42
NdeII GATC 1 cut(s) 61
NruI TCGCGA 1 cut(s) 42
Psp6I CCWGG 1 cut(s) 29
PspGI CCWGG 1 cut(s) 29
PsuI RGATCY 1 cut(s) 61
RruI TCGCGA 1 cut(s) 42
RsaI GTAC 1 cut(s) 137
RsaNI GTAC 1 cut(s) 136
RseI CAYNNNNRTG 1 cut(s) 127
SaqAI TTAA 1 cut(s) 141
Sau3AI GATC 1 cut(s) 61
ScrFI CCNGG 1 cut(s) 31
SetI ASST 4 cut(s) 49, 60, 78, 141
SfaNI GCATC 1 cut(s) 131
SgeI CNNG 8 cut(s) 42, 43, 53, 71, 92, 104, 109, 123
SmiMI CAYNNNNRTG 1 cut(s) 127
Sse9I AATT 2 cut(s) 117, 154
SspMI CTAG 2 cut(s) 59, 111
StyD4I CCNGG 1 cut(s) 29
TasI AATT 2 cut(s) 117, 154
Tru1I TTAA 1 cut(s) 141
Tru9I TTAA 1 cut(s) 141
TscAI CASTG 1 cut(s) 134
TspRI CASTG 1 cut(s) 134
XspI CTAG 2 cut(s) 59, 111
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.