AT1G06320

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
OG0002484
Physical Location & Seq
Forward (+)
1930523 .. 1931449
927 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G06320.1

Sequence Viewer

Length: 588 bp
ATGAAGAATGGAGGAGAGAAGAAGATAACAGTGGAAGAATACGTTGAGTTCTGCAACTCTGGGAATTCCATCCATTTCACCATCGCTTACCTCAATCAGATCCTTCATTTGCATGGTTTCCGAAAGCTTCACAAATTACAGAAGAAAATTGTAGAAGAAGCCGTGGACTCACTGGATCTTCTAGATCTCTCTCGCTCAACTCTGAAACAAGTCACTGACTCCTCGCCGTCATCGTCATCCCTAACTCTCGACGAAGTGATAAGCGACATCGAAGCTCTGAAATGGCAGGAATGCTGCTTTACCTCACTCCAGATCATCAATTCCCAGGAAACTACTCCATCAGAAATCTCCAAACCGAAACAGAAATCGAACAAGAGAAAGAAAGCTACTATGAAGAAATCTCTCAACACTAATTTCGGTGATGAGAATGACAACACAATGATGATGATGCTCCCAACGAAAAAGATGAGAAACAAAAAGACGACGAAGAACCTCAAAAGCATCTCCACATTTGTCAAAGACGCTTCATCAGCATCCAAACCACTCTCTGCCAACAATTTATCATCAAGGTTTTCTTCTTTTCCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

195

Amino Acids

21.96

Weight (kDa)

9.44

Isoelectric Point (pI)

46.05

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF7787 PF25042 6 - 62 1.7e-21 Domain of unknown function (DUF7787)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 94, 183
AcsI RAATTY 1 cut(s) 64
AjnI CCWGG 1 cut(s) 324
AluBI AGCT 3 cut(s) 127, 275, 386
AluI AGCT 3 cut(s) 127, 275, 386
AlwI GGATC 2 cut(s) 94, 183
ApeKI GCWGC 1 cut(s) 294
ApoI RAATTY 1 cut(s) 64
AsuHPI GGTGA 2 cut(s) 70, 431
BbvI GCAGC 1 cut(s) 281
BccI CCATC 3 cut(s) 77, 89, 346
BceAI ACGGC 2 cut(s) 146, 211
BciT130I CCWGG 1 cut(s) 326
BfaI CTAG 1 cut(s) 182
BglII AGATCT 1 cut(s) 184
BisI GCNGC 1 cut(s) 295
BlsI GCNGC 1 cut(s) 296
Bme1390I CCNGG 1 cut(s) 326
BmrFI CCNGG 1 cut(s) 326
BmsI GCATC 3 cut(s) 438, 510, 542
BpmI CTGGAG 1 cut(s) 293
BsaJI CCNNGG 2 cut(s) 162, 324
Bse1I ACTGG 1 cut(s) 177
BseBI CCWGG 1 cut(s) 326
BseDI CCNNGG 2 cut(s) 162, 324
BseGI GGATG 3 cut(s) 69, 236, 533
BseNI ACTGG 1 cut(s) 177
BseRI GAGGAG 2 cut(s) 27, 211
BseXI GCAGC 1 cut(s) 281
BsmI GAATGC 1 cut(s) 296
Bsp143I GATC 4 cut(s) 99, 175, 184, 312
BspPI GGATC 2 cut(s) 94, 183
BsrI ACTGG 1 cut(s) 177
BssECI CCNNGG 2 cut(s) 162, 324
BssMI GATC 4 cut(s) 99, 175, 184, 312
Bst2UI CCWGG 1 cut(s) 326
Bst4CI ACNGT 1 cut(s) 31
BstDSI CCRYGG 1 cut(s) 162
BstF5I GGATG 3 cut(s) 69, 236, 533
BstKTI GATC 4 cut(s) 102, 178, 187, 315
BstMBI GATC 4 cut(s) 99, 175, 184, 312
BstMWI GCNNNNNNNGC 1 cut(s) 530
BstNI CCWGG 1 cut(s) 326
BstSCI CCNGG 1 cut(s) 324
BstV1I GCAGC 1 cut(s) 281
BstX2I RGATCY 3 cut(s) 99, 175, 184
BstYI RGATCY 3 cut(s) 99, 175, 184
BtgI CCRYGG 1 cut(s) 162
BtgZI GCGATG 1 cut(s) 67
BtsCI GGATG 3 cut(s) 69, 236, 533
BtsIMutI CAGTG 3 cut(s) 36, 170, 213
CseI GACGC 1 cut(s) 530
CviAII CATG 1 cut(s) 113
CviJI RGCY 4 cut(s) 127, 161, 275, 386
CviKI_1 RGCY 4 cut(s) 127, 161, 275, 386
DpnI GATC 4 cut(s) 101, 177, 186, 314
DpnII GATC 4 cut(s) 99, 175, 184, 312
EcoRI GAATTC 1 cut(s) 64
EcoRII CCWGG 1 cut(s) 324
FaeI CATG 1 cut(s) 116
FaiI YATR 3 cut(s) 114, 392, 586
FalI AAGNNNNNCTT 1 cut(s) 559
FatI CATG 1 cut(s) 112
Fnu4HI GCNGC 1 cut(s) 295
FokI GGATG 3 cut(s) 56, 223, 520
Fsp4HI GCNGC 1 cut(s) 295
FspBI CTAG 1 cut(s) 182
GluI GCNGC 1 cut(s) 295
GsuI CTGGAG 1 cut(s) 293
HgaI GACGC 1 cut(s) 530
Hin1II CATG 1 cut(s) 116
HindIII AAGCTT 1 cut(s) 125
HinfI GANTC 2 cut(s) 167, 218
HphI GGTGA 2 cut(s) 70, 431
Hpy166II GTNNAC 1 cut(s) 166
Hpy188I TCNGA 5 cut(s) 99, 122, 204, 279, 343
Hpy188III TCNNGA 3 cut(s) 182, 248, 310
Hpy8I GTNNAC 1 cut(s) 166
Hpy99I CGWCG 2 cut(s) 254, 487
HpyAV CCTTC 1 cut(s) 113
HpyCH4III ACNGT 1 cut(s) 31
HpyCH4IV ACGT 1 cut(s) 42
HpyCH4V TGCA 2 cut(s) 54, 112
HpyF10VI GCNNNNNNNGC 1 cut(s) 530
HpySE526I ACGT 1 cut(s) 42
Hsp92II CATG 1 cut(s) 116
Kzo9I GATC 4 cut(s) 99, 175, 184, 312
LmnI GCTCC 1 cut(s) 456
LpnPI CCDG 6 cut(s) 45, 158, 272, 311, 323, 338
Lsp1109I GCAGC 1 cut(s) 281
LweI GCATC 3 cut(s) 438, 510, 542
MaeI CTAG 1 cut(s) 182
MaeII ACGT 1 cut(s) 42
MaeIII GTNAC 1 cut(s) 211
MalI GATC 4 cut(s) 101, 177, 186, 314
MboI GATC 4 cut(s) 99, 175, 184, 312
MflI RGATCY 3 cut(s) 99, 175, 184
MluCI AATT 6 cut(s) 64, 134, 147, 319, 412, 556
MlyI GAGTC 2 cut(s) 161, 212
MnlI CCTC 5 cut(s) 5, 101, 232, 313, 503
MslI CAYNNNNRTG 2 cut(s) 111, 440
MspR9I CCNGG 1 cut(s) 326
Mva1269I GAATGC 1 cut(s) 296
MvaI CCWGG 1 cut(s) 326
MwoI GCNNNNNNNGC 1 cut(s) 530
NdeII GATC 4 cut(s) 99, 175, 184, 312
NlaIII CATG 1 cut(s) 116
NmuCI GTSAC 1 cut(s) 211
PcsI WCGNNNNNNNCGW 1 cut(s) 230
PctI GAATGC 1 cut(s) 296
PkrI GCNGC 1 cut(s) 296
PleI GAGTC 2 cut(s) 161, 212
PpsI GAGTC 2 cut(s) 161, 212
Psp6I CCWGG 1 cut(s) 324
PspGI CCWGG 1 cut(s) 324
PsuI RGATCY 3 cut(s) 99, 175, 184
RseI CAYNNNNRTG 2 cut(s) 111, 440
SatI GCNGC 1 cut(s) 295
Sau3AI GATC 4 cut(s) 99, 175, 184, 312
SchI GAGTC 2 cut(s) 161, 212
ScrFI CCNGG 1 cut(s) 326
SetI ASST 8 cut(s) 45, 93, 129, 277, 305, 388, 495, 572
SfaNI GCATC 3 cut(s) 438, 510, 542
SmiMI CAYNNNNRTG 2 cut(s) 111, 440
Sse9I AATT 6 cut(s) 64, 134, 147, 319, 412, 556
SspMI CTAG 1 cut(s) 182
StyD4I CCNGG 1 cut(s) 324
TaaI ACNGT 1 cut(s) 31
TaiI ACGT 1 cut(s) 45
TaqI TCGA 3 cut(s) 249, 270, 368
TasI AATT 6 cut(s) 64, 134, 147, 319, 412, 556
TscAI CASTG 3 cut(s) 36, 177, 220
TseFI GTSAC 1 cut(s) 211
TseI GCWGC 1 cut(s) 294
Tsp45I GTSAC 1 cut(s) 211
TspDTI ATGAA 4 cut(s) 17, 95, 407, 516
TspRI CASTG 3 cut(s) 36, 177, 220
XapI RAATTY 1 cut(s) 64
XbaI TCTAGA 1 cut(s) 181
XspI CTAG 1 cut(s) 182
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.