Rorug02G0286000

No description available

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Forward (+)
31162456 .. 31163395
940 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0286000.1

Sequence Viewer

Length: 717 bp
ATGGAAGATGACAACCATGGAAATAATAGGCTAAATGGTCCAAATGGAGGAAGCCCTGAAAACCCATGTTTAAACAACAGCACTCCTGCTAGTAGCTGCAACTCCAACATTAATATTCACCACAATCATAATCAAAGTAACAATCACAATCACCACCACCACAGCAGCAATAAAGAACAAGACAGGTTTCTTCCCATTGCGAATGTGGGTCGCATTATGAAGAAAGTGATTCCGGGCAATGGAAAAATCTCGAAAGACGCAAAAGAGACTGTCCAAGAATGTGTGTCCGAGTTCATTAGCTTTGTCACCGGTGAAGCCTCTGATAAATGTCAAAGGGAAAAGAGGAAGACCATTAACGGCGAAGACATCATATGGGCTATCACAACACTAGGCTTTGAGGATTACGTGCACCCTCTAAAATTGTACCTCCAAAAATATAGAGAGCTTGAAGGGGAGAAGCTAAATGTTCCAAAGCAACAAAGATTGGAGCAAAGGCTGCAGCAACAGCAACAACAGCAAGTAGTACAACAAGAACAAGAGCAACAAAGTATACCAAATTCGTATAGTGTATATTCATCGACGAGTCTCTTGTCTCAACCGACTTCTTTCATCACTACTCATCATCATGATCCCGCATTTTCGTTGCCTTTCTCGCCAAGCTCAATTCAAAAACAGCTACAGCCACAAGATCAGATTGATTCAGTGGGGCATTGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

238

Amino Acids

27.08

Weight (kDa)

6.38

Isoelectric Point (pI)

56.31

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Histone PF00125 51 - 127 2.3e-07 Core histone H2A/H2B/H3/H4 domain
CBFD_NFYB_HMF PF00808 63 - 127 6e-28 Histone-like transcription factor (CBF/NF-Y) and archaeal histone
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 550
AciI CCGC 1 cut(s) 633
AclWI GGATC 1 cut(s) 623
AcsI RAATTY 1 cut(s) 556
AfaI GTAC 2 cut(s) 425, 525
AfiI CCNNNNNNNGG 2 cut(s) 47, 239
AgeI ACCGGT 1 cut(s) 308
AgsI TTSAA 2 cut(s) 449, 668
AluBI AGCT 6 cut(s) 96, 300, 445, 460, 660, 676
AluI AGCT 6 cut(s) 96, 300, 445, 460, 660, 676
Alw21I GWGCWC 1 cut(s) 411
Alw26I GTCTC 3 cut(s) 260, 590, 597
Alw44I GTGCAC 1 cut(s) 407
AlwI GGATC 1 cut(s) 623
ApaLI GTGCAC 1 cut(s) 407
ApeKI GCWGC 4 cut(s) 96, 165, 496, 499
ApoI RAATTY 1 cut(s) 556
AseI ATTAAT 1 cut(s) 111
AsiGI ACCGGT 1 cut(s) 308
AspS9I GGNCC 1 cut(s) 38
AsuC2I CCSGG 1 cut(s) 234
AsuHPI GGTGA 4 cut(s) 110, 143, 298, 323
AvaII GGWCC 1 cut(s) 38
BaeGI GKGCMC 1 cut(s) 411
BbsI GAAGAC 2 cut(s) 353, 369
Bbv12I GWGCWC 1 cut(s) 411
BbvI GCAGC 4 cut(s) 83, 177, 483, 511
BceAI ACGGC 1 cut(s) 373
BcnI CCSGG 1 cut(s) 234
BcoDI GTCTC 3 cut(s) 260, 590, 597
BfaI CTAG 2 cut(s) 90, 389
BfmI CTRYAG 2 cut(s) 497, 677
BisI GCNGC 4 cut(s) 97, 166, 497, 500
BlsI GCNGC 4 cut(s) 98, 167, 498, 501
Bme1390I CCNGG 1 cut(s) 234
Bme18I GGWCC 1 cut(s) 38
BmgT120I GGNCC 1 cut(s) 38
BmrFI CCNGG 1 cut(s) 234
BpiI GAAGAC 2 cut(s) 353, 369
BpuMI CCSGG 1 cut(s) 234
BsaAI YACGTR 1 cut(s) 406
BsaJI CCNNGG 1 cut(s) 16
BsaWI WCCGGW 1 cut(s) 308
Bsc4I CCNNNNNNNGG 2 cut(s) 47, 239
Bse118I RCCGGY 1 cut(s) 308
Bse3DI GCAATG 2 cut(s) 195, 244
BseDI CCNNGG 1 cut(s) 16
BseLI CCNNNNNNNGG 2 cut(s) 47, 239
BseMI GCAATG 2 cut(s) 195, 244
BseSI GKGCMC 1 cut(s) 411
BseXI GCAGC 4 cut(s) 83, 177, 483, 511
BshTI ACCGGT 1 cut(s) 308
BsiHKAI GWGCWC 1 cut(s) 411
BsiSI CCGG 2 cut(s) 233, 309
BslI CCNNNNNNNGG 2 cut(s) 47, 239
BsmAI GTCTC 3 cut(s) 260, 590, 597
Bsp1286I GDGCHC 1 cut(s) 411
Bsp143I GATC 2 cut(s) 628, 688
Bsp19I CCATGG 1 cut(s) 16
BspACI CCGC 1 cut(s) 633
BspHI TCATGA 1 cut(s) 625
BspMAI CTGCAG 1 cut(s) 501
BspPI GGATC 1 cut(s) 623
BsrDI GCAATG 2 cut(s) 195, 244
BsrFI RCCGGY 1 cut(s) 308
BssAI RCCGGY 1 cut(s) 308
BssECI CCNNGG 1 cut(s) 16
BssMI GATC 2 cut(s) 628, 688
BssNAI GTATAC 1 cut(s) 551
BssT1I CCWWGG 1 cut(s) 16
Bst1107I GTATAC 1 cut(s) 551
Bst4CI ACNGT 1 cut(s) 271
BstAPI GCANNNNNTGC 1 cut(s) 496
BstBAI YACGTR 1 cut(s) 406
BstDSI CCRYGG 1 cut(s) 16
BstKTI GATC 2 cut(s) 631, 691
BstMAI GTCTC 3 cut(s) 260, 590, 597
BstMBI GATC 2 cut(s) 628, 688
BstMWI GCNNNNNNNGC 4 cut(s) 496, 505, 514, 652
BstSCI CCNGG 1 cut(s) 232
BstSFI CTRYAG 2 cut(s) 497, 677
BstSLI GKGCMC 1 cut(s) 411
BstV1I GCAGC 4 cut(s) 83, 177, 483, 511
BstV2I GAAGAC 2 cut(s) 353, 369
BstZ17I GTATAC 1 cut(s) 551
BtgI CCRYGG 1 cut(s) 16
BtsIMutI CAGTG 1 cut(s) 708
CciI TCATGA 1 cut(s) 625
Cfr10I RCCGGY 1 cut(s) 308
Cfr13I GGNCC 1 cut(s) 38
CseI GACGC 1 cut(s) 266
Csp6I GTAC 2 cut(s) 424, 524
CspAI ACCGGT 1 cut(s) 308
CviAII CATG 3 cut(s) 17, 66, 626
CviQI GTAC 2 cut(s) 424, 524
DpnI GATC 2 cut(s) 630, 690
DpnII GATC 2 cut(s) 628, 688
DraI TTTAAA 1 cut(s) 72
Eco130I CCWWGG 1 cut(s) 16
Eco47I GGWCC 1 cut(s) 38
EcoT14I CCWWGG 1 cut(s) 16
ErhI CCWWGG 1 cut(s) 16
FaeI CATG 3 cut(s) 20, 69, 629
FatI CATG 3 cut(s) 16, 65, 625
FauI CCCGC 1 cut(s) 640
FauNDI CATATG 1 cut(s) 371
FblI GTMKAC 1 cut(s) 550
Fnu4HI GCNGC 4 cut(s) 97, 166, 497, 500
Fsp4HI GCNGC 4 cut(s) 97, 166, 497, 500
FspBI CTAG 2 cut(s) 90, 389
GluI GCNGC 4 cut(s) 97, 166, 497, 500
HapII CCGG 2 cut(s) 233, 309
HgaI GACGC 1 cut(s) 266
Hin1II CATG 3 cut(s) 20, 69, 629
HinfI GANTC 3 cut(s) 229, 583, 698
HpaII CCGG 2 cut(s) 233, 309
HphI GGTGA 4 cut(s) 110, 143, 298, 323
Hpy166II GTNNAC 2 cut(s) 409, 551
Hpy188I TCNGA 3 cut(s) 289, 322, 693
Hpy188III TCNNGA 2 cut(s) 250, 626
Hpy8I GTNNAC 2 cut(s) 409, 551
Hpy99I CGWCG 1 cut(s) 583
HpyAV CCTTC 1 cut(s) 443
HpyCH4III ACNGT 1 cut(s) 271
HpyCH4IV ACGT 1 cut(s) 405
HpyCH4V TGCA 3 cut(s) 99, 409, 499
HpyF10VI GCNNNNNNNGC 4 cut(s) 496, 505, 514, 652
HpySE526I ACGT 1 cut(s) 405
Hsp92II CATG 3 cut(s) 20, 69, 629
Kzo9I GATC 2 cut(s) 628, 688
LmnI GCTCC 1 cut(s) 487
LpnPI CCDG 5 cut(s) 69, 99, 169, 246, 322
Lsp1109I GCAGC 4 cut(s) 83, 177, 483, 511
MaeI CTAG 2 cut(s) 90, 389
MaeII ACGT 1 cut(s) 405
MaeIII GTNAC 2 cut(s) 137, 304
MalI GATC 2 cut(s) 630, 690
MboI GATC 2 cut(s) 628, 688
MboII GAAGA 5 cut(s) 17, 182, 232, 358, 374
MhlI GDGCHC 1 cut(s) 411
MluCI AATT 3 cut(s) 419, 556, 663
MlyI GAGTC 1 cut(s) 592
MmeI TCCRAC 1 cut(s) 129
MnlI CCTC 6 cut(s) 41, 328, 336, 391, 423, 437
MseI TTAA 3 cut(s) 71, 111, 354
MslI CAYNNNNRTG 1 cut(s) 624
MspI CCGG 2 cut(s) 233, 309
MspR9I CCNGG 1 cut(s) 234
MssI GTTTAAAC 1 cut(s) 72
MwoI GCNNNNNNNGC 4 cut(s) 496, 505, 514, 652
NciI CCSGG 1 cut(s) 234
NcoI CCATGG 1 cut(s) 16
NdeI CATATG 1 cut(s) 371
NdeII GATC 2 cut(s) 628, 688
NlaIII CATG 3 cut(s) 20, 69, 629
NmuCI GTSAC 1 cut(s) 304
PagI TCATGA 1 cut(s) 625
PfeI GAWTC 2 cut(s) 229, 698
PinAI ACCGGT 1 cut(s) 308
PkrI GCNGC 4 cut(s) 98, 167, 498, 501
PleI GAGTC 1 cut(s) 591
PmeI GTTTAAAC 1 cut(s) 72
PpsI GAGTC 1 cut(s) 591
Ppu21I YACGTR 1 cut(s) 406
PshBI ATTAAT 1 cut(s) 111
PspPI GGNCC 1 cut(s) 38
PstI CTGCAG 1 cut(s) 501
RsaI GTAC 2 cut(s) 425, 525
RsaNI GTAC 2 cut(s) 424, 524
RseI CAYNNNNRTG 1 cut(s) 624
SaqAI TTAA 3 cut(s) 71, 111, 354
SatI GCNGC 4 cut(s) 97, 166, 497, 500
Sau3AI GATC 2 cut(s) 628, 688
Sau96I GGNCC 1 cut(s) 38
SchI GAGTC 1 cut(s) 592
ScrFI CCNGG 1 cut(s) 234
SduI GDGCHC 1 cut(s) 411
SetI ASST 9 cut(s) 98, 188, 302, 408, 429, 447, 462, 662, 678
SfcI CTRYAG 2 cut(s) 497, 677
SgrAI CRCCGGYG 1 cut(s) 308
SinI GGWCC 1 cut(s) 38
SmiMI CAYNNNNRTG 1 cut(s) 624
Sse9I AATT 3 cut(s) 419, 556, 663
SsiI CCGC 1 cut(s) 633
SspI AATATT 1 cut(s) 115
SspMI CTAG 2 cut(s) 90, 389
StyD4I CCNGG 1 cut(s) 232
StyI CCWWGG 1 cut(s) 16
TaaI ACNGT 1 cut(s) 271
TaiI ACGT 1 cut(s) 408
TaqI TCGA 2 cut(s) 251, 578
TasI AATT 3 cut(s) 419, 556, 663
TatI WGTACW 1 cut(s) 523
TfiI GAWTC 2 cut(s) 229, 698
Tru1I TTAA 3 cut(s) 71, 111, 354
Tru9I TTAA 3 cut(s) 71, 111, 354
TscAI CASTG 1 cut(s) 708
TseFI GTSAC 1 cut(s) 304
TseI GCWGC 4 cut(s) 96, 165, 496, 499
Tsp45I GTSAC 1 cut(s) 304
TspDTI ATGAA 4 cut(s) 233, 283, 564, 598
TspRI CASTG 1 cut(s) 708
VneI GTGCAC 1 cut(s) 407
VpaK11BI GGWCC 1 cut(s) 38
VspI ATTAAT 1 cut(s) 111
XapI RAATTY 1 cut(s) 556
XcmI CCANNNNNNNNNTGG 1 cut(s) 202
XmiI GTMKAC 1 cut(s) 550
XspI CTAG 2 cut(s) 90, 389
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.