AT1G50760

Plant mobile domain

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
arabidopsis_thaliana
1
OG0002054
Physical Location & Seq
Reverse (-)
18814947 .. 18815309
363 bp
Loading structure...
UTR
Exon/CDS
Intron
AT1G50760.1

Sequence Viewer

Length: 261 bp
ATGAAGTTCAAGCGTTGGGCTAGAAAAATGTCTGCTTTGCACGAACCCATATGGAGAAAAGCTGGGATCTTTGAAGCAGTTAATGCATCCACATACAAGATCCACAAAAACACAGATCTCGTTCTTGGTGTTGCTGAGAAATGGTCTCCCGACACCAAAACCTTCGTTTTCTCTTGGGGTGAAGCTACAATAACACTTGAAGACGTTATGCTCAGGAAAGAAGATTATGGAGAGGCTAAAGAACGCATGGCAGACGATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PMD

Protein Analysis

86

Amino Acids

10.02

Weight (kDa)

7.99

Isoelectric Point (pI)

36.35

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PMD PF10536 22 - 71 3.2e-21 Plant mobile domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 74, 94
AgsI TTSAA 3 cut(s) 10, 74, 200
AluBI AGCT 2 cut(s) 62, 185
AluI AGCT 2 cut(s) 62, 185
Alw26I GTCTC 1 cut(s) 150
AlwI GGATC 2 cut(s) 74, 94
AsuHPI GGTGA 1 cut(s) 191
BbsI GAAGAC 1 cut(s) 207
BcoDI GTCTC 1 cut(s) 150
BfaI CTAG 1 cut(s) 21
BglII AGATCT 1 cut(s) 115
BmsI GCATC 1 cut(s) 95
BpiI GAAGAC 1 cut(s) 207
Bpu10I CCTNAGC 1 cut(s) 212
BsaI GGTCTC 1 cut(s) 150
BseGI GGATG 1 cut(s) 86
BseMII CTCAG 2 cut(s) 126, 226
BseYI CCCAGC 1 cut(s) 62
BsmAI GTCTC 1 cut(s) 150
Bso31I GGTCTC 1 cut(s) 150
Bsp143I GATC 3 cut(s) 66, 99, 115
BspCNI CTCAG 2 cut(s) 127, 225
BspPI GGATC 2 cut(s) 74, 94
BspTNI GGTCTC 1 cut(s) 150
BssMI GATC 3 cut(s) 66, 99, 115
BstAPI GCANNNNNTGC 1 cut(s) 83
BstDEI CTNAG 2 cut(s) 135, 212
BstF5I GGATG 1 cut(s) 86
BstKTI GATC 3 cut(s) 69, 102, 118
BstMAI GTCTC 1 cut(s) 150
BstMBI GATC 3 cut(s) 66, 99, 115
BstMWI GCNNNNNNNGC 1 cut(s) 83
BstV2I GAAGAC 1 cut(s) 207
BstX2I RGATCY 3 cut(s) 66, 99, 115
BstYI RGATCY 3 cut(s) 66, 99, 115
BtsCI GGATG 1 cut(s) 86
CviAII CATG 1 cut(s) 247
CviJI RGCY 4 cut(s) 20, 62, 185, 236
CviKI_1 RGCY 4 cut(s) 20, 62, 185, 236
DdeI CTNAG 2 cut(s) 135, 212
DpnI GATC 3 cut(s) 68, 101, 117
DpnII GATC 3 cut(s) 66, 99, 115
Eco31I GGTCTC 1 cut(s) 150
EcoT22I ATGCAT 1 cut(s) 88
FaeI CATG 1 cut(s) 250
FaiI YATR 6 cut(s) 50, 52, 94, 209, 228, 248
FatI CATG 1 cut(s) 246
FauNDI CATATG 1 cut(s) 50
FokI GGATG 1 cut(s) 73
FspBI CTAG 1 cut(s) 21
GsaI CCCAGC 1 cut(s) 66
Hin1II CATG 1 cut(s) 250
HphI GGTGA 1 cut(s) 191
Hpy188III TCNNGA 2 cut(s) 149, 214
HpyAV CCTTC 1 cut(s) 172
HpyCH4IV ACGT 1 cut(s) 204
HpyCH4V TGCA 2 cut(s) 40, 86
HpyF10VI GCNNNNNNNGC 1 cut(s) 83
HpyF3I CTNAG 2 cut(s) 135, 212
HpySE526I ACGT 1 cut(s) 204
Hsp92II CATG 1 cut(s) 250
Kzo9I GATC 3 cut(s) 66, 99, 115
LpnPI CCDG 2 cut(s) 48, 199
LweI GCATC 1 cut(s) 95
MaeI CTAG 1 cut(s) 21
MaeII ACGT 1 cut(s) 204
MalI GATC 3 cut(s) 68, 101, 117
MboI GATC 3 cut(s) 66, 99, 115
MboII GAAGA 2 cut(s) 212, 233
MflI RGATCY 3 cut(s) 66, 99, 115
MnlI CCTC 1 cut(s) 226
Mph1103I ATGCAT 1 cut(s) 88
MseI TTAA 2 cut(s) 81, 259
MwoI GCNNNNNNNGC 1 cut(s) 83
NdeI CATATG 1 cut(s) 50
NdeII GATC 3 cut(s) 66, 99, 115
NlaIII CATG 1 cut(s) 250
NsiI ATGCAT 1 cut(s) 88
PspFI CCCAGC 1 cut(s) 62
PsuI RGATCY 3 cut(s) 66, 99, 115
SaqAI TTAA 2 cut(s) 81, 259
Sau3AI GATC 3 cut(s) 66, 99, 115
SetI ASST 4 cut(s) 64, 164, 187, 207
SfaNI GCATC 1 cut(s) 95
SspMI CTAG 1 cut(s) 21
TaiI ACGT 1 cut(s) 207
Tru1I TTAA 2 cut(s) 81, 259
Tru9I TTAA 2 cut(s) 81, 259
TspDTI ATGAA 1 cut(s) 17
XspI CTAG 1 cut(s) 21
Zsp2I ATGCAT 1 cut(s) 88
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.