Basic Information

Type: gene

Biological Identity

Species

fragaria_vesca

Chromosome

Fvb2

Orthogroup ID

OG0000844

Physical Location & Seq

Genomic Coordinates Forward (+)

4382345 .. 4383454

Gene Structure 1110 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

FvH4_2g05330.t1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 549 bp

ATGGGTGGAGCCATTTCTAGACTTGCAAAGAGGTTCTTTCCAGAGAATGGAGTGAGGATATTAATGGTGGGTCTTGATGCTTCAGGAAAGACTACCATCCTCTACAAGCTAAAACTAGGAGAGATTGTTTCAACCATACCCACAATTGGTTTTAATGTGGAGACTATAGAGTACAAGAACATTACCTTCACTGTCTGGGATGTCGGAGGACAAGATAAGATAAGGCCTTTGTGGAGGCATTACTTTAAGAATACTCAAGGACTTATATTTACTGTGGACAGCAATGACAGGGAACGAATCCCAGAAGCTCGCAATGAGCTTCATCGTATTCTAAGTGAGTGTGAACTAAGTAATGCAGTAGTCCTGGTCCTTGCTAATAAGCAAGACCTTCCAAATGCTATGTGTGCTACCGAGGTTGCTGATAAACTCGCACTCCACTTACTTGGTCAACGTTCCTGGTACATCCAGAGTACCTCTGCAACCTCTGGCCAAGGACTCTATGAAGGCCTTGATTGGCTATCTAACAACATTAGTGCTACCAAGAAATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko04072 ko04144 ko05110 ko05134 map04072 map04144 map05110 map05134

Pfam Domains

Protein Families

Arf

Protein Analysis

183

Amino Acids

20.36

Weight (kDa)

8.53

Isoelectric Point (pI)

41.67

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Arf	PF00025	9 - 177	4.8e-73	ADP-ribosylation factor family
Ras	PF00071	19 - 176	7.6e-14	Ras family
Roc	PF08477	19 - 129	1.1e-13	Ras of Complex, Roc, domain of DAPkinase
SRPRB	PF09439	19 - 143	2.8e-12	Signal recognition particle receptor beta subunit
Gtr1_RagA	PF04670	19 - 140	4e-10	Gtr1/RagA G protein conserved region
G-alpha	PF00503	45 - 130	2.9e-08	G-protein alpha subunit

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0000844)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G14670 AT5G14670 AT5G14670
fragaria_vesca	FvH4_1g26580 FvH4_2g05330 FvH4_4g34150 FvH4_6g50940
malus_domestica	MD02G1178300.v1.1 MD05G1087900.v1.1 MD09G1288000.v1.1 MD13G1093800.v1.1 MD16G1095100.v1.1 MD17G1032200.v1.1 MD17G1280300.v1.1
prunus_persica	Prupe.1G251500_v2.0.a1 Prupe.1G251500_v2.0.a1 Prupe.1G251500_v2.0.a1 Prupe.3G005200_v2.0.a1 Prupe.3G005200_v2.0.a1 Prupe.3G005200_v2.0.a1 Prupe.6G229500_v2.0.a1 Prupe.6G229500_v2.0.a1 Prupe.8G134000_v2.0.a1
pyrus_communis	pycom02g14440 pycom05g08740 pycom09g19540 pycom16g08120 pycom17g27820
rosa_chinensis	RchiOBHm_Chr2g0106611 RchiOBHm_Chr2g0172341 RchiOBHm_Chr3g0486681 RchiOBHm_Chr4g0443661 RchiOBHm_Chr6g0255541
rosa_laevigata	RLG00000005904 RLG00000014832 RLG00000017521 RLG00000023067
rosa_multiflora	Rmu_co8483849.1_g000001 Rmu_sc0000261.1_g000013 Rmu_sc0000467.1_g000011 Rmu_sc0001426.1_g000018 Rmu_sc0002360.1_g000004 Rmu_sc0006202.1_g000005 Rmu_sc0006221.1_g000007
rosa_roxburghii	Rroxscaffold_2G00136970 Rroxscaffold_5G00384210 Rroxscaffold_6G00395670 Rroxscaffold_7G00209900
rosa_rugosa	Rorug02G0136700 Rorug02G0136800 Rorug03G0226500 Rorug03G0226600 Rorug03G0226700 Rorug05G0559300
rosa_samantha	Rh2BG198900 Rh2BG647400 Rh2CG614300 Rh2DG194100 Rh2DG662200 Rh4CG431500 Rh6AG077800 Rh6DG065500
rosa_wichuraiana	Rw2G014750 Rw2G052480 Rw3G024590 Rw4G034860 Rw6G006700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	47
AclI	AACGTT	1 cut(s)	451
AcoI	YGGCCR	1 cut(s)	487
AcuI	CTGAAG	1 cut(s)	66
AfaI	GTAC	3 cut(s)	173, 461, 472
AfiI	CCNNNNNNNGG	2 cut(s)	47, 146
AgsI	TTSAA	1 cut(s)	132
AjnI	CCWGG	2 cut(s)	363, 455
AluBI	AGCT	3 cut(s)	109, 308, 319
AluI	AGCT	3 cut(s)	109, 308, 319
Alw26I	GTCTC	1 cut(s)	155
AoxI	GGCC	3 cut(s)	224, 487, 505
AseI	ATTAAT	1 cut(s)	62
AspS9I	GGNCC	1 cut(s)	367
AvaII	GGWCC	1 cut(s)	367
BalI	TGGCCA	1 cut(s)	489
BccI	CCATC	1 cut(s)	104
BciT130I	CCWGG	2 cut(s)	365, 457
BcoDI	GTCTC	1 cut(s)	155
BfaI	CTAG	2 cut(s)	18, 116
BfmI	CTRYAG	1 cut(s)	165
Bme1390I	CCNGG	2 cut(s)	365, 457
Bme18I	GGWCC	1 cut(s)	367
BmgT120I	GGNCC	1 cut(s)	367
BmiI	GGNNCC	1 cut(s)	10
BmrFI	CCNGG	2 cut(s)	365, 457
BmsI	GCATC	1 cut(s)	67
BpuEI	CTTGAG	1 cut(s)	240
BsaJI	CCNNGG	2 cut(s)	411, 490
BsaXI	ACNNNNNCTCC	4 cut(s)	111, 141, 417, 447
Bsc4I	CCNNNNNNNGG	2 cut(s)	47, 146
Bse3DI	GCAATG	2 cut(s)	289, 319
BseBI	CCWGG	2 cut(s)	365, 457
BseDI	CCNNGG	2 cut(s)	411, 490
BseGI	GGATG	3 cut(s)	96, 205, 462
BseLI	CCNNNNNNNGG	2 cut(s)	47, 146
BseMI	GCAATG	2 cut(s)	289, 319
BshFI	GGCC	3 cut(s)	226, 489, 507
BslI	CCNNNNNNNGG	2 cut(s)	47, 146
BsmAI	GTCTC	1 cut(s)	155
BsnI	GGCC	3 cut(s)	226, 489, 507
BspANI	GGCC	3 cut(s)	226, 489, 507
BspLI	GGNNCC	1 cut(s)	10
BsrDI	GCAATG	2 cut(s)	289, 319
BssECI	CCNNGG	2 cut(s)	411, 490
BssT1I	CCWWGG	1 cut(s)	490
Bst2UI	CCWGG	2 cut(s)	365, 457
Bst4CI	ACNGT	2 cut(s)	193, 274
BstC8I	GCNNGC	1 cut(s)	310
BstDEI	CTNAG	2 cut(s)	332, 347
BstF5I	GGATG	3 cut(s)	96, 205, 462
BstMAI	GTCTC	1 cut(s)	155
BstMWI	GCNNNNNNNGC	1 cut(s)	404
BstNI	CCWGG	2 cut(s)	365, 457
BstSCI	CCNGG	2 cut(s)	363, 455
BstSFI	CTRYAG	1 cut(s)	165
BstXI	CCANNNNNNTGG	1 cut(s)	443
BsuRI	GGCC	3 cut(s)	226, 489, 507
BtsCI	GGATG	3 cut(s)	96, 205, 462
BtsIMutI	CAGTG	1 cut(s)	189
Cac8I	GCNNGC	1 cut(s)	310
Cfr13I	GGNCC	1 cut(s)	367
Csp6I	GTAC	3 cut(s)	172, 460, 471
CviJI	RGCY	8 cut(s)	11, 109, 226, 308, 319, 489, 507, 517
CviKI_1	RGCY	8 cut(s)	11, 109, 226, 308, 319, 489, 507, 517
CviQI	GTAC	3 cut(s)	172, 460, 471
DdeI	CTNAG	2 cut(s)	332, 347
EaeI	YGGCCR	1 cut(s)	487
Eco130I	CCWWGG	1 cut(s)	490
Eco147I	AGGCCT	2 cut(s)	226, 507
Eco47I	GGWCC	1 cut(s)	367
Eco57I	CTGAAG	1 cut(s)	66
EcoRII	CCWGG	2 cut(s)	363, 455
EcoT14I	CCWWGG	1 cut(s)	490
ErhI	CCWWGG	1 cut(s)	490
FaiI	YATR	5 cut(s)	137, 167, 266, 401, 501
FalI	AAGNNNNNCTT	2 cut(s)	20, 52
FokI	GGATG	3 cut(s)	83, 212, 449
FspBI	CTAG	2 cut(s)	18, 116
HaeIII	GGCC	3 cut(s)	226, 489, 507
HincII	GTYRAC	1 cut(s)	449
HindII	GTYRAC	1 cut(s)	449
HinfI	GANTC	2 cut(s)	297, 495
Hpy166II	GTNNAC	3 cut(s)	277, 344, 449
Hpy188I	TCNGA	1 cut(s)	206
Hpy188III	TCNNGA	5 cut(s)	18, 41, 74, 84, 466
Hpy8I	GTNNAC	3 cut(s)	277, 344, 449
HpyAV	CCTTC	3 cut(s)	196, 398, 497
HpyCH4III	ACNGT	2 cut(s)	193, 274
HpyCH4IV	ACGT	1 cut(s)	451
HpyCH4V	TGCA	3 cut(s)	26, 356, 479
HpyF10VI	GCNNNNNNNGC	1 cut(s)	404
HpyF3I	CTNAG	2 cut(s)	332, 347
HpySE526I	ACGT	1 cut(s)	451
LmnI	GCTCC	1 cut(s)	8
LweI	GCATC	1 cut(s)	67
MaeI	CTAG	2 cut(s)	18, 116
MaeII	ACGT	1 cut(s)	451
MfeI	CAATTG	1 cut(s)	144
MlsI	TGGCCA	1 cut(s)	489
MluCI	AATT	1 cut(s)	144
MluNI	TGGCCA	1 cut(s)	489
MlyI	GAGTC	1 cut(s)	489
MmeI	TCCRAC	1 cut(s)	184
MnlI	CCTC	8 cut(s)	24, 48, 110, 200, 228, 406, 484, 493
Mox20I	TGGCCA	1 cut(s)	489
MscI	TGGCCA	1 cut(s)	489
MseI	TTAA	3 cut(s)	62, 153, 246
Msp20I	TGGCCA	1 cut(s)	489
MspR9I	CCNGG	2 cut(s)	365, 457
MunI	CAATTG	1 cut(s)	144
MvaI	CCWGG	2 cut(s)	365, 457
MwoI	GCNNNNNNNGC	1 cut(s)	404
NlaIV	GGNNCC	1 cut(s)	10
PceI	AGGCCT	2 cut(s)	226, 507
PfeI	GAWTC	1 cut(s)	297
PflMI	CCANNNNNTGG	1 cut(s)	47
PleI	GAGTC	1 cut(s)	489
PpsI	GAGTC	1 cut(s)	489
PshBI	ATTAAT	1 cut(s)	62
Psp1406I	AACGTT	1 cut(s)	451
Psp6I	CCWGG	2 cut(s)	363, 455
PspGI	CCWGG	2 cut(s)	363, 455
PspN4I	GGNNCC	1 cut(s)	10
PspPI	GGNCC	1 cut(s)	367
RsaI	GTAC	3 cut(s)	173, 461, 472
RsaNI	GTAC	3 cut(s)	172, 460, 471
SaqAI	TTAA	3 cut(s)	62, 153, 246
Sau96I	GGNCC	1 cut(s)	367
SchI	GAGTC	1 cut(s)	489
ScrFI	CCNGG	2 cut(s)	365, 457
SfaNI	GCATC	1 cut(s)	67
SfcI	CTRYAG	1 cut(s)	165
SinI	GGWCC	1 cut(s)	367
SmlI	CTYRAG	1 cut(s)	255
SmoI	CTYRAG	1 cut(s)	255
Sse9I	AATT	1 cut(s)	144
SseBI	AGGCCT	2 cut(s)	226, 507
SspMI	CTAG	2 cut(s)	18, 116
StuI	AGGCCT	2 cut(s)	226, 507
StyD4I	CCNGG	2 cut(s)	363, 455
StyI	CCWWGG	1 cut(s)	490
TaaI	ACNGT	2 cut(s)	193, 274
TaiI	ACGT	1 cut(s)	454
TasI	AATT	1 cut(s)	144
TatI	WGTACW	1 cut(s)	171
TfiI	GAWTC	1 cut(s)	297
Tru1I	TTAA	3 cut(s)	62, 153, 246
Tru9I	TTAA	3 cut(s)	62, 153, 246
TscAI	CASTG	1 cut(s)	196
TspDTI	ATGAA	2 cut(s)	311, 516
TspRI	CASTG	1 cut(s)	196
Van91I	CCANNNNNTGG	1 cut(s)	47
VpaK11BI	GGWCC	1 cut(s)	367
VspI	ATTAAT	1 cut(s)	62
XbaI	TCTAGA	1 cut(s)	17
XspI	CTAG	2 cut(s)	18, 116

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.