RLG00000014832

ADP-ribosylation factor

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr3
Physical Location & Seq
Reverse (-)
58176008 .. 58177341
1334 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000014832

Sequence Viewer

Length: 549 bp
ATGGGTGGAGCCATTTCTAGACTTGCAAAGAGGTTCTTTCCAAAGAATGGAGTGAGGATATTAATGGTGGGTCTTGATGCTTCCGGAAAGACTACCATCCTCTACAAGCTGAAACTAGGAGAGATTGTTTCATCAGTACCCACAATTGGTTTCAATGTGGAGACAATAGAGTACAAGAACATCACCTTCACTGTTTGGGATGTTGGAGGACAAGACAAGATAAGGCCTTTGTGGAGGCATTACTTTAAGAACACTCAAGGACTTATATTTACTGTGGACAGCAATGACAGGGAACGAATCCCAGAAGCTCGCAATGAGCTTCATCGTATTCTAAGCGAGAGTGAACTCAGCAATGCAGTAGTCCTGGTCCTAGCTAATAAGCAAGACCTTCCAAATGCTATGTGTGCTACCGAGGTTGCTGATAAACTTGCACTCCACTTACTTGGTCAACGTTCCTGGTACATCCAAGGTACTTCTGCAACCTCTGGCCAAGGACTCTATGAAGGTCTCGATTGGCTATCTAATACCATCAGTACTACCAAGAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

183

Amino Acids

20.3

Weight (kDa)

9.21

Isoelectric Point (pI)

36.93

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Arf PF00025 9 - 177 4.9e-73 ADP-ribosylation factor family
Roc PF08477 19 - 129 1.4e-13 Ras of Complex, Roc, domain of DAPkinase
Ras PF00071 19 - 175 4.8e-13 Ras family
SRPRB PF09439 19 - 143 1.5e-12 Signal recognition particle receptor beta subunit
Gtr1_RagA PF04670 19 - 140 9e-10 Gtr1/RagA G protein conserved region
G-alpha PF00503 44 - 130 8.8e-09 G-protein alpha subunit
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 47
AccIII TCCGGA 1 cut(s) 83
AclI AACGTT 1 cut(s) 451
AcoI YGGCCR 1 cut(s) 487
AfaI GTAC 5 cut(s) 138, 173, 461, 472, 535
AfiI CCNNNNNNNGG 2 cut(s) 47, 146
AgsI TTSAA 1 cut(s) 154
AjnI CCWGG 2 cut(s) 363, 455
AluBI AGCT 4 cut(s) 109, 308, 319, 374
AluI AGCT 4 cut(s) 109, 308, 319, 374
Alw26I GTCTC 2 cut(s) 155, 512
Aor13HI TCCGGA 1 cut(s) 83
AoxI GGCC 2 cut(s) 224, 487
AseI ATTAAT 1 cut(s) 62
AspS9I GGNCC 1 cut(s) 367
AsuHPI GGTGA 1 cut(s) 175
AvaII GGWCC 1 cut(s) 367
BalI TGGCCA 1 cut(s) 489
BccI CCATC 2 cut(s) 104, 536
BciT130I CCWGG 2 cut(s) 365, 457
BcoDI GTCTC 2 cut(s) 155, 512
BfaI CTAG 3 cut(s) 18, 116, 371
BmcAI AGTACT 1 cut(s) 535
Bme1390I CCNGG 2 cut(s) 365, 457
Bme18I GGWCC 1 cut(s) 367
BmgT120I GGNCC 1 cut(s) 367
BmiI GGNNCC 1 cut(s) 10
BmrFI CCNGG 2 cut(s) 365, 457
BmsI GCATC 1 cut(s) 67
BpuEI CTTGAG 1 cut(s) 240
BsaI GGTCTC 1 cut(s) 512
BsaJI CCNNGG 3 cut(s) 411, 466, 490
BsaWI WCCGGW 1 cut(s) 83
BsaXI ACNNNNNCTCC 4 cut(s) 111, 141, 417, 447
Bsc4I CCNNNNNNNGG 2 cut(s) 47, 146
Bse3DI GCAATG 3 cut(s) 289, 319, 358
BseAI TCCGGA 1 cut(s) 83
BseBI CCWGG 2 cut(s) 365, 457
BseDI CCNNGG 3 cut(s) 411, 466, 490
BseGI GGATG 3 cut(s) 96, 205, 462
BseLI CCNNNNNNNGG 2 cut(s) 47, 146
BseMI GCAATG 3 cut(s) 289, 319, 358
BseMII CTCAG 1 cut(s) 361
BshFI GGCC 2 cut(s) 226, 489
BsiSI CCGG 1 cut(s) 84
BslI CCNNNNNNNGG 2 cut(s) 47, 146
BsmAI GTCTC 2 cut(s) 155, 512
BsnI GGCC 2 cut(s) 226, 489
Bso31I GGTCTC 1 cut(s) 512
Bsp13I TCCGGA 1 cut(s) 83
BspANI GGCC 2 cut(s) 226, 489
BspCNI CTCAG 1 cut(s) 360
BspEI TCCGGA 1 cut(s) 83
BspLI GGNNCC 1 cut(s) 10
BspTNI GGTCTC 1 cut(s) 512
BsrDI GCAATG 3 cut(s) 289, 319, 358
BssECI CCNNGG 3 cut(s) 411, 466, 490
BssT1I CCWWGG 2 cut(s) 466, 490
Bst2UI CCWGG 2 cut(s) 365, 457
Bst4CI ACNGT 2 cut(s) 193, 274
BstC8I GCNNGC 1 cut(s) 310
BstDEI CTNAG 2 cut(s) 332, 347
BstF5I GGATG 3 cut(s) 96, 205, 462
BstMAI GTCTC 2 cut(s) 155, 512
BstMWI GCNNNNNNNGC 1 cut(s) 404
BstNI CCWGG 2 cut(s) 365, 457
BstSCI CCNGG 2 cut(s) 363, 455
BstXI CCANNNNNNTGG 1 cut(s) 443
BsuRI GGCC 2 cut(s) 226, 489
BtsCI GGATG 3 cut(s) 96, 205, 462
BtsIMutI CAGTG 1 cut(s) 189
Cac8I GCNNGC 1 cut(s) 310
Cfr13I GGNCC 1 cut(s) 367
Csp6I GTAC 5 cut(s) 137, 172, 460, 471, 534
CviJI RGCY 8 cut(s) 11, 109, 226, 308, 319, 374, 489, 517
CviKI_1 RGCY 8 cut(s) 11, 109, 226, 308, 319, 374, 489, 517
CviQI GTAC 5 cut(s) 137, 172, 460, 471, 534
DdeI CTNAG 2 cut(s) 332, 347
EaeI YGGCCR 1 cut(s) 487
Eco130I CCWWGG 2 cut(s) 466, 490
Eco147I AGGCCT 1 cut(s) 226
Eco31I GGTCTC 1 cut(s) 512
Eco47I GGWCC 1 cut(s) 367
EcoRII CCWGG 2 cut(s) 363, 455
EcoT14I CCWWGG 2 cut(s) 466, 490
ErhI CCWWGG 2 cut(s) 466, 490
FaiI YATR 3 cut(s) 266, 401, 501
FalI AAGNNNNNCTT 2 cut(s) 20, 52
FokI GGATG 3 cut(s) 83, 212, 449
FspBI CTAG 3 cut(s) 18, 116, 371
HaeIII GGCC 2 cut(s) 226, 489
HapII CCGG 1 cut(s) 84
HincII GTYRAC 1 cut(s) 449
HindII GTYRAC 1 cut(s) 449
HinfI GANTC 2 cut(s) 297, 495
HpaII CCGG 1 cut(s) 84
HphI GGTGA 1 cut(s) 175
Hpy166II GTNNAC 3 cut(s) 277, 344, 449
Hpy188III TCNNGA 4 cut(s) 18, 74, 84, 509
Hpy8I GTNNAC 3 cut(s) 277, 344, 449
HpyAV CCTTC 3 cut(s) 196, 398, 497
HpyCH4III ACNGT 2 cut(s) 193, 274
HpyCH4IV ACGT 1 cut(s) 451
HpyCH4V TGCA 4 cut(s) 26, 356, 431, 479
HpyF10VI GCNNNNNNNGC 1 cut(s) 404
HpyF3I CTNAG 2 cut(s) 332, 347
HpySE526I ACGT 1 cut(s) 451
Kpn2I TCCGGA 1 cut(s) 83
LmnI GCTCC 1 cut(s) 8
LpnPI CCDG 8 cut(s) 97, 274, 315, 350, 377, 442, 469, 471
LweI GCATC 1 cut(s) 67
MaeI CTAG 3 cut(s) 18, 116, 371
MaeII ACGT 1 cut(s) 451
MfeI CAATTG 1 cut(s) 144
MlsI TGGCCA 1 cut(s) 489
MluCI AATT 1 cut(s) 144
MluNI TGGCCA 1 cut(s) 489
MlyI GAGTC 1 cut(s) 489
MmeI TCCRAC 1 cut(s) 184
MnlI CCTC 7 cut(s) 24, 48, 110, 200, 228, 406, 493
Mox20I TGGCCA 1 cut(s) 489
MroI TCCGGA 1 cut(s) 83
MscI TGGCCA 1 cut(s) 489
MseI TTAA 2 cut(s) 62, 246
Msp20I TGGCCA 1 cut(s) 489
MspI CCGG 1 cut(s) 84
MspR9I CCNGG 2 cut(s) 365, 457
MunI CAATTG 1 cut(s) 144
MvaI CCWGG 2 cut(s) 365, 457
MwoI GCNNNNNNNGC 1 cut(s) 404
NlaIV GGNNCC 1 cut(s) 10
PceI AGGCCT 1 cut(s) 226
PfeI GAWTC 1 cut(s) 297
PflMI CCANNNNNTGG 1 cut(s) 47
PleI GAGTC 1 cut(s) 489
PpsI GAGTC 1 cut(s) 489
PshBI ATTAAT 1 cut(s) 62
Psp1406I AACGTT 1 cut(s) 451
Psp6I CCWGG 2 cut(s) 363, 455
PspGI CCWGG 2 cut(s) 363, 455
PspN4I GGNNCC 1 cut(s) 10
PspPI GGNCC 1 cut(s) 367
RsaI GTAC 5 cut(s) 138, 173, 461, 472, 535
RsaNI GTAC 5 cut(s) 137, 172, 460, 471, 534
SaqAI TTAA 2 cut(s) 62, 246
Sau96I GGNCC 1 cut(s) 367
ScaI AGTACT 1 cut(s) 535
SchI GAGTC 1 cut(s) 489
ScrFI CCNGG 2 cut(s) 365, 457
SfaNI GCATC 1 cut(s) 67
SinI GGWCC 1 cut(s) 367
SmlI CTYRAG 1 cut(s) 255
SmoI CTYRAG 1 cut(s) 255
Sse9I AATT 1 cut(s) 144
SseBI AGGCCT 1 cut(s) 226
SspMI CTAG 3 cut(s) 18, 116, 371
StuI AGGCCT 1 cut(s) 226
StyD4I CCNGG 2 cut(s) 363, 455
StyI CCWWGG 2 cut(s) 466, 490
TaaI ACNGT 2 cut(s) 193, 274
TaiI ACGT 1 cut(s) 454
TaqI TCGA 1 cut(s) 510
TasI AATT 1 cut(s) 144
TatI WGTACW 2 cut(s) 171, 533
TfiI GAWTC 1 cut(s) 297
Tru1I TTAA 2 cut(s) 62, 246
Tru9I TTAA 2 cut(s) 62, 246
TscAI CASTG 1 cut(s) 196
TspDTI ATGAA 3 cut(s) 120, 311, 516
TspRI CASTG 1 cut(s) 196
Van91I CCANNNNNTGG 1 cut(s) 47
VpaK11BI GGWCC 1 cut(s) 367
VspI ATTAAT 1 cut(s) 62
XbaI TCTAGA 1 cut(s) 17
XspI CTAG 3 cut(s) 18, 116, 371
ZrmI AGTACT 1 cut(s) 535
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.