FvH4_5g17111
MYB Family

Myb-related protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb5
OG0001619
Physical Location & Seq
Forward (+)
9759525 .. 9761766
2242 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_5g17111.t1

Sequence Viewer

Length: 567 bp
ATGAGGAAGCCCTGCTGCGAGAAGACGGAGACGACTAAAGGGGCGTGGTCGATCCAAGAAGATCAGAAACTCATTGACTACATCCAAAAACACGGCGAAGGTTGCTGGAATTCGCTTCCTAAGGCTGCAGGGTTGCGTCGTTGTGGTAAGAGTTGTCGACTGAGATGGATAAACTATCTACGACCTGATCTTAAACGAGGGAGCTTTAGTGAAGATGAAGAGGATCTCATCATCAGGCTTCATAAACTCCTTGGGAATAGGTGGTCGCTAATAGCTGGAAGACTGCCTGGAAGGACAGATAACGAAGTGAAGAACTACTGGAACTCTCATTTAAAGAAGAAGATACTGAACACAGGCACTACTCTTCGTCCAAATAAGCCCCGCCCTGAGATTAAGCATGCACCTTATAACAAACTTGTCAAGTACTTCAATGAGATGGACGATGAGGTCGTTGATGAGGTCTCATCAGCCGATTCTGCTGCTGGCTGTTTGGTGCCTGAGTTGAATCTCGACCTCACTTTAAGCATCAAGACTAGTACTGGAATGGCTGATCCTCAAGTTGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Myb_DNA-binding

Protein Analysis

189

Amino Acids

21.41

Weight (kDa)

8.99

Isoelectric Point (pI)

42.71

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Myb_DNA-binding PF00249 13 - 60 9.5e-17 Myb-like DNA-binding domain
Myb_DNA-bind_6 PF13921 16 - 74 2.7e-12 Myb-like DNA-binding domain
Myb_DNA-binding PF00249 66 - 111 2.8e-18 Myb-like DNA-binding domain
Myb_DNA-bind_6 PF13921 69 - 116 2.5e-09 Myb-like DNA-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 408
AasI GACNNNNNNGTC 1 cut(s) 446
AccB1I GGYRCC 1 cut(s) 493
AccI GTMKAC 1 cut(s) 157
AciI CCGC 1 cut(s) 382
AclWI GGATC 3 cut(s) 46, 231, 545
AcsI RAATTY 1 cut(s) 109
AfaI GTAC 2 cut(s) 425, 538
AgsI TTSAA 2 cut(s) 430, 505
AhlI ACTAGT 1 cut(s) 533
AjnI CCWGG 1 cut(s) 286
AluBI AGCT 2 cut(s) 204, 275
AluI AGCT 2 cut(s) 204, 275
Alw26I GTCTC 2 cut(s) 23, 466
AlwI GGATC 3 cut(s) 46, 231, 545
ApeKI GCWGC 3 cut(s) 15, 125, 479
ApoI RAATTY 1 cut(s) 109
AxyI CCTNAGG 1 cut(s) 120
BanI GGYRCC 1 cut(s) 493
BbsI GAAGAC 2 cut(s) 29, 286
BbvI GCAGC 3 cut(s) 2, 112, 466
BccI CCATC 2 cut(s) 159, 430
BceAI ACGGC 1 cut(s) 109
BcgI CGANNNNNNTGC 2 cut(s) 461, 495
BciT130I CCWGG 1 cut(s) 288
BcoDI GTCTC 2 cut(s) 23, 466
BcuI ACTAGT 1 cut(s) 533
BfaI CTAG 1 cut(s) 534
BfmI CTRYAG 1 cut(s) 126
BisI GCNGC 3 cut(s) 16, 126, 480
BlsI GCNGC 3 cut(s) 17, 127, 481
BmcAI AGTACT 2 cut(s) 425, 538
Bme1390I CCNGG 1 cut(s) 288
BmiI GGNNCC 1 cut(s) 495
BmrFI CCNGG 1 cut(s) 288
BmsI GCATC 1 cut(s) 534
BpiI GAAGAC 2 cut(s) 29, 286
BpuEI CTTGAG 1 cut(s) 540
BsaI GGTCTC 1 cut(s) 466
BsaJI CCNNGG 1 cut(s) 250
BsaXI ACNNNNNCTCC 2 cut(s) 193, 223
Bse1I ACTGG 2 cut(s) 323, 544
Bse21I CCTNAGG 1 cut(s) 120
BseBI CCWGG 1 cut(s) 288
BseDI CCNNGG 1 cut(s) 250
BseGI GGATG 1 cut(s) 81
BseMII CTCAG 3 cut(s) 152, 378, 489
BseNI ACTGG 2 cut(s) 323, 544
BseXI GCAGC 3 cut(s) 2, 112, 466
BshNI GGYRCC 1 cut(s) 493
BsmAI GTCTC 2 cut(s) 23, 466
BsmBI CGTCTC 1 cut(s) 23
Bso31I GGTCTC 1 cut(s) 466
Bsp143I GATC 5 cut(s) 51, 61, 187, 223, 550
BspACI CCGC 1 cut(s) 382
BspCNI CTCAG 3 cut(s) 153, 379, 490
BspLI GGNNCC 1 cut(s) 495
BspMAI CTGCAG 1 cut(s) 130
BspPI GGATC 3 cut(s) 46, 231, 545
BspT107I GGYRCC 1 cut(s) 493
BspTNI GGTCTC 1 cut(s) 466
BsrI ACTGG 2 cut(s) 323, 544
BssECI CCNNGG 1 cut(s) 250
BssMI GATC 5 cut(s) 51, 61, 187, 223, 550
BssT1I CCWWGG 1 cut(s) 250
Bst2UI CCWGG 1 cut(s) 288
Bst6I CTCTTC 2 cut(s) 213, 369
BstC8I GCNNGC 2 cut(s) 399, 484
BstDEI CTNAG 4 cut(s) 120, 161, 387, 498
BstF5I GGATG 1 cut(s) 81
BstKTI GATC 5 cut(s) 54, 64, 190, 226, 553
BstMAI GTCTC 2 cut(s) 23, 466
BstMBI GATC 5 cut(s) 51, 61, 187, 223, 550
BstMWI GCNNNNNNNGC 2 cut(s) 102, 476
BstNI CCWGG 1 cut(s) 288
BstNSI RCATGY 1 cut(s) 401
BstSCI CCNGG 1 cut(s) 286
BstSFI CTRYAG 1 cut(s) 126
BstV1I GCAGC 3 cut(s) 2, 112, 466
BstV2I GAAGAC 2 cut(s) 29, 286
BstX2I RGATCY 1 cut(s) 223
BstYI RGATCY 1 cut(s) 223
Bsu36I CCTNAGG 1 cut(s) 120
BtsCI GGATG 1 cut(s) 81
Cac8I GCNNGC 2 cut(s) 399, 484
CseI GACGC 1 cut(s) 125
Csp6I GTAC 2 cut(s) 424, 537
CviAII CATG 1 cut(s) 398
CviJI RGCY 9 cut(s) 10, 125, 204, 238, 275, 379, 470, 486, 548
CviKI_1 RGCY 9 cut(s) 10, 125, 204, 238, 275, 379, 470, 486, 548
CviQI GTAC 2 cut(s) 424, 537
DdeI CTNAG 4 cut(s) 120, 161, 387, 498
DpnI GATC 5 cut(s) 53, 63, 189, 225, 552
DpnII GATC 5 cut(s) 51, 61, 187, 223, 550
DraI TTTAAA 1 cut(s) 333
DrdI GACNNNNNNGTC 1 cut(s) 446
DseDI GACNNNNNNGTC 1 cut(s) 446
Eam1104I CTCTTC 2 cut(s) 213, 369
EarI CTCTTC 2 cut(s) 213, 369
Eco130I CCWWGG 1 cut(s) 250
Eco31I GGTCTC 1 cut(s) 466
Eco81I CCTNAGG 1 cut(s) 120
EcoRI GAATTC 1 cut(s) 109
EcoRII CCWGG 1 cut(s) 286
EcoT14I CCWWGG 1 cut(s) 250
ErhI CCWWGG 1 cut(s) 250
Esp3I CGTCTC 1 cut(s) 23
FaeI CATG 1 cut(s) 401
FaiI YATR 3 cut(s) 243, 399, 408
FatI CATG 1 cut(s) 397
FauI CCCGC 1 cut(s) 389
FblI GTMKAC 1 cut(s) 157
Fnu4HI GCNGC 3 cut(s) 16, 126, 480
FokI GGATG 1 cut(s) 68
Fsp4HI GCNGC 3 cut(s) 16, 126, 480
FspBI CTAG 1 cut(s) 534
GluI GCNGC 3 cut(s) 16, 126, 480
HgaI GACGC 1 cut(s) 125
Hin1II CATG 1 cut(s) 401
HincII GTYRAC 1 cut(s) 158
HindII GTYRAC 1 cut(s) 158
HinfI GANTC 2 cut(s) 473, 505
Hpy166II GTNNAC 1 cut(s) 158
Hpy188I TCNGA 1 cut(s) 66
Hpy188III TCNNGA 2 cut(s) 509, 529
Hpy8I GTNNAC 1 cut(s) 158
Hpy99I CGWCG 1 cut(s) 141
HpyAV CCTTC 2 cut(s) 92, 285
HpyCH4V TGCA 2 cut(s) 128, 401
HpyF10VI GCNNNNNNNGC 2 cut(s) 102, 476
HpyF3I CTNAG 4 cut(s) 120, 161, 387, 498
Hsp92II CATG 1 cut(s) 401
Kzo9I GATC 5 cut(s) 51, 61, 187, 223, 550
LmnI GCTCC 1 cut(s) 201
Lsp1109I GCAGC 3 cut(s) 2, 112, 466
LweI GCATC 1 cut(s) 534
MaeI CTAG 1 cut(s) 534
MalI GATC 5 cut(s) 53, 63, 189, 225, 552
MboI GATC 5 cut(s) 51, 61, 187, 223, 550
MboII GAAGA 9 cut(s) 34, 71, 224, 230, 291, 322, 349, 352, 356
MflI RGATCY 1 cut(s) 223
MluCI AATT 1 cut(s) 109
MnlI CCTC 6 cut(s) 191, 214, 439, 451, 524, 564
MseI TTAA 5 cut(s) 192, 332, 393, 521, 565
MspR9I CCNGG 1 cut(s) 288
MvaI CCWGG 1 cut(s) 288
MwoI GCNNNNNNNGC 2 cut(s) 102, 476
NdeII GATC 5 cut(s) 51, 61, 187, 223, 550
NlaIII CATG 1 cut(s) 401
NlaIV GGNNCC 1 cut(s) 495
NspI RCATGY 1 cut(s) 401
PaeI GCATGC 1 cut(s) 401
PcsI WCGNNNNNNNCGW 1 cut(s) 447
PfeI GAWTC 2 cut(s) 473, 505
PkrI GCNGC 3 cut(s) 17, 127, 481
PsiI TTATAA 1 cut(s) 408
Psp6I CCWGG 1 cut(s) 286
PspGI CCWGG 1 cut(s) 286
PspN4I GGNNCC 1 cut(s) 495
PstI CTGCAG 1 cut(s) 130
PsuI RGATCY 1 cut(s) 223
RsaI GTAC 2 cut(s) 425, 538
RsaNI GTAC 2 cut(s) 424, 537
SalI GTCGAC 1 cut(s) 156
SaqAI TTAA 5 cut(s) 192, 332, 393, 521, 565
SatI GCNGC 3 cut(s) 16, 126, 480
Sau3AI GATC 5 cut(s) 51, 61, 187, 223, 550
ScaI AGTACT 2 cut(s) 425, 538
ScrFI CCNGG 1 cut(s) 288
SetI ASST 9 cut(s) 103, 187, 206, 263, 277, 406, 450, 462, 516
SfaNI GCATC 1 cut(s) 534
SfcI CTRYAG 1 cut(s) 126
SmlI CTYRAG 1 cut(s) 555
SmoI CTYRAG 1 cut(s) 555
SpeI ACTAGT 1 cut(s) 533
SphI GCATGC 1 cut(s) 401
Sse9I AATT 1 cut(s) 109
SsiI CCGC 1 cut(s) 382
SspMI CTAG 1 cut(s) 534
StyD4I CCNGG 1 cut(s) 286
StyI CCWWGG 1 cut(s) 250
TaqI TCGA 3 cut(s) 50, 157, 510
TasI AATT 1 cut(s) 109
TatI WGTACW 2 cut(s) 423, 536
TfiI GAWTC 2 cut(s) 473, 505
Tru1I TTAA 5 cut(s) 192, 332, 393, 521, 565
Tru9I TTAA 5 cut(s) 192, 332, 393, 521, 565
TseI GCWGC 3 cut(s) 15, 125, 479
TspDTI ATGAA 2 cut(s) 230, 231
TspGWI ACGGA 1 cut(s) 41
XapI RAATTY 1 cut(s) 109
XceI RCATGY 1 cut(s) 401
XmiI GTMKAC 1 cut(s) 157
XspI CTAG 1 cut(s) 534
ZrmI AGTACT 2 cut(s) 425, 538
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.