MD06G1064300.v1.1
MYB Family

Myb-like DNA-binding domain

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr06
Physical Location & Seq
Reverse (-)
13167506 .. 13167838
333 bp
Loading structure...
UTR
Exon/CDS
Intron
MD06G1064300.v1.1.491

Sequence Viewer

Length: 333 bp
ATGGTTTTCTGCTTGTTTTGGACATATAGGTGGTCCAAGATTGCAGGCAGATTGCCAGGGAGAACAGATAATGAGATCAAGAATCATTGGAACACCCATATCAAGAAAAAGCTGCTTAGGATGGGAATTGATCCTGTCACGCATGAACCCCTCCACAAAGAAGAAGAGTTGCCTTCCAATATTAAGGAAAATAACTCATCATCATCTTCCCATGATCATGATGATCATGACAATAATTTGCCAGCTGATAAGTCTATAAATGGTGTTCACAATTCACAAGAAAATGATCAAAACGTGGTGAATTCATCAGGATCGGAGGGCATAAACTCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

111

Amino Acids

12.54

Weight (kDa)

6.02

Isoelectric Point (pI)

52.95

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Myb_DNA-binding PF00249 10 - 33 7.2e-09 Myb-like DNA-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 125, 319
AcsI RAATTY 1 cut(s) 301
AjnI CCWGG 1 cut(s) 55
AluBI AGCT 2 cut(s) 112, 245
AluI AGCT 2 cut(s) 112, 245
AlwI GGATC 2 cut(s) 125, 319
ApeKI GCWGC 1 cut(s) 112
ApoI RAATTY 1 cut(s) 301
AspS9I GGNCC 1 cut(s) 33
AsuHPI GGTGA 1 cut(s) 310
AvaII GGWCC 1 cut(s) 33
BbvI GCAGC 1 cut(s) 99
BccI CCATC 1 cut(s) 115
BciT130I CCWGG 1 cut(s) 57
BclI TGATCA 3 cut(s) 214, 223, 286
BisI GCNGC 1 cut(s) 113
BlsI GCNGC 1 cut(s) 114
Bme1390I CCNGG 1 cut(s) 57
Bme18I GGWCC 1 cut(s) 33
BmgT120I GGNCC 1 cut(s) 33
BmrFI CCNGG 1 cut(s) 57
Bpu10I CCTNAGC 1 cut(s) 116
BsaJI CCNNGG 1 cut(s) 56
BseBI CCWGG 1 cut(s) 57
BseDI CCNNGG 1 cut(s) 56
BseGI GGATG 1 cut(s) 126
BseXI GCAGC 1 cut(s) 99
Bsp143I GATC 6 cut(s) 75, 130, 214, 223, 286, 311
BspHI TCATGA 2 cut(s) 217, 226
BspPI GGATC 2 cut(s) 125, 319
BssECI CCNNGG 1 cut(s) 56
BssMI GATC 6 cut(s) 75, 130, 214, 223, 286, 311
Bst2UI CCWGG 1 cut(s) 57
Bst6I CTCTTC 1 cut(s) 159
BstC8I GCNNGC 2 cut(s) 46, 243
BstDEI CTNAG 1 cut(s) 116
BstF5I GGATG 1 cut(s) 126
BstKTI GATC 6 cut(s) 78, 133, 217, 226, 289, 314
BstMBI GATC 6 cut(s) 75, 130, 214, 223, 286, 311
BstNI CCWGG 1 cut(s) 57
BstSCI CCNGG 1 cut(s) 55
BstV1I GCAGC 1 cut(s) 99
BtsCI GGATG 1 cut(s) 126
Cac8I GCNNGC 2 cut(s) 46, 243
CciI TCATGA 2 cut(s) 217, 226
Cfr13I GGNCC 1 cut(s) 33
CviAII CATG 4 cut(s) 143, 212, 218, 227
CviJI RGCY 2 cut(s) 112, 245
CviKI_1 RGCY 2 cut(s) 112, 245
DdeI CTNAG 1 cut(s) 116
DpnI GATC 6 cut(s) 77, 132, 216, 225, 288, 313
DpnII GATC 6 cut(s) 75, 130, 214, 223, 286, 311
Eam1104I CTCTTC 1 cut(s) 159
EarI CTCTTC 1 cut(s) 159
Eco47I GGWCC 1 cut(s) 33
EcoRI GAATTC 1 cut(s) 301
EcoRII CCWGG 1 cut(s) 55
FaeI CATG 4 cut(s) 146, 215, 221, 230
FatI CATG 4 cut(s) 142, 211, 217, 226
FbaI TGATCA 3 cut(s) 214, 223, 286
Fnu4HI GCNGC 1 cut(s) 113
FokI GGATG 1 cut(s) 133
Fsp4HI GCNGC 1 cut(s) 113
GluI GCNGC 1 cut(s) 113
Hin1II CATG 4 cut(s) 146, 215, 221, 230
HinfI GANTC 1 cut(s) 82
HphI GGTGA 1 cut(s) 310
Hpy166II GTNNAC 1 cut(s) 268
Hpy188I TCNGA 1 cut(s) 316
Hpy188III TCNNGA 5 cut(s) 79, 103, 218, 227, 309
Hpy8I GTNNAC 1 cut(s) 268
HpyAV CCTTC 1 cut(s) 183
HpyCH4IV ACGT 1 cut(s) 294
HpyCH4V TGCA 1 cut(s) 44
HpyF3I CTNAG 1 cut(s) 116
HpySE526I ACGT 1 cut(s) 294
Hsp92II CATG 4 cut(s) 146, 215, 221, 230
Ksp22I TGATCA 3 cut(s) 214, 223, 286
Kzo9I GATC 6 cut(s) 75, 130, 214, 223, 286, 311
LpnPI CCDG 6 cut(s) 30, 42, 69, 147, 255, 294
Lsp1109I GCAGC 1 cut(s) 99
MaeII ACGT 1 cut(s) 294
MaeIII GTNAC 1 cut(s) 136
MalI GATC 6 cut(s) 77, 132, 216, 225, 288, 313
MboI GATC 6 cut(s) 75, 130, 214, 223, 286, 311
MboII GAAGA 3 cut(s) 173, 176, 198
MluCI AATT 4 cut(s) 126, 235, 271, 301
MnlI CCTC 2 cut(s) 161, 310
MseI TTAA 1 cut(s) 183
MslI CAYNNNNRTG 2 cut(s) 28, 216
MspA1I CMGCKG 1 cut(s) 245
MspR9I CCNGG 1 cut(s) 57
MvaI CCWGG 1 cut(s) 57
NdeII GATC 6 cut(s) 75, 130, 214, 223, 286, 311
NlaIII CATG 4 cut(s) 146, 215, 221, 230
NmuCI GTSAC 1 cut(s) 136
PagI TCATGA 2 cut(s) 217, 226
PfeI GAWTC 1 cut(s) 82
PkrI GCNGC 1 cut(s) 114
Psp6I CCWGG 1 cut(s) 55
PspGI CCWGG 1 cut(s) 55
PspPI GGNCC 1 cut(s) 33
PvuII CAGCTG 1 cut(s) 245
RseI CAYNNNNRTG 2 cut(s) 28, 216
SaqAI TTAA 1 cut(s) 183
SatI GCNGC 1 cut(s) 113
Sau3AI GATC 6 cut(s) 75, 130, 214, 223, 286, 311
Sau96I GGNCC 1 cut(s) 33
ScrFI CCNGG 1 cut(s) 57
SetI ASST 4 cut(s) 32, 114, 247, 297
SinI GGWCC 1 cut(s) 33
SmiMI CAYNNNNRTG 2 cut(s) 28, 216
Sse9I AATT 4 cut(s) 126, 235, 271, 301
SspI AATATT 1 cut(s) 181
StyD4I CCNGG 1 cut(s) 55
TaiI ACGT 1 cut(s) 297
TasI AATT 4 cut(s) 126, 235, 271, 301
TfiI GAWTC 1 cut(s) 82
Tru1I TTAA 1 cut(s) 183
Tru9I TTAA 1 cut(s) 183
TseFI GTSAC 1 cut(s) 136
TseI GCWGC 1 cut(s) 112
Tsp45I GTSAC 1 cut(s) 136
TspDTI ATGAA 2 cut(s) 159, 294
VpaK11BI GGWCC 1 cut(s) 33
XapI RAATTY 1 cut(s) 301
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.