FvH4_6g09000

function. Its presence in a non-photosynthetic plant (Epifagus virginiana) and experiments in tobacco indicate that it has an essential function which is probably not related to photosynthesis

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb6
OG0004273
Physical Location & Seq
Forward (+)
5305655 .. 5307185
1531 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_6g09000.t1

Sequence Viewer

Length: 696 bp
ATGGCGATACATTTATACAAAACTTCTACCCCGAGCACACGCAATGGAGCCGTAGACAGTCAAGTGAAATCCAATCCACGAAATAATTTGATCTATGGACAGCATCGTTGTAGTAAGATTCTAAATTGGACACTGAAACAAACTTGGGATTTGCGATCCCAAGTAAGATCGGTTCAGGATCATGGGATCCTTTTCTATCAGATAGGAAGGGCCGTTGCACAAAATGTACTTCTAAGTAATTGCTCCATAGATCCTATATCTATCTATATGAAGAAGAAATCATGTAACGAGGGGGGTTCTTATTTGTACAAATGGTACTTCGAACTTGGAACGAGCATGAAGAAATTAACGATACTTCTTTATCTTTTGAGTTGTTCTGCCGGATCGGTCGCTCAAGACCTTTGGTCTCTACCCGGACCCGATGAAAAAAACGGGATTACTTCTTATGGACTCGTTGAGAATGATTCTGATCTAGTTCATGGCCTATTAGAAGTAGAAGGCGCGCCGGTGGGATCCTCCCGGACAGCGTCTACCATTATACCTACAATGATCGGGCATACTATTGCTATCCATAACGGAAAGGAGCATTTGCCTATTTATATAACAGATCGTATGGTAGGACATAAATTGGGAGAATTTTCACCGACTCTAAATTTCCGGGGGCATGCGAAAAATGATAATAGATCTCGGCGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AAA DUF825

Protein Analysis

232

Amino Acids

25.76

Weight (kDa)

9.33

Isoelectric Point (pI)

33.97

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S19 PF00203 174 - 222 1.3e-21 Ribosomal protein S19
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 54, 530
AccII CGCG 1 cut(s) 503
AclWI GGATC 8 cut(s) 150, 181, 186, 194, 245, 391, 507, 520
AcsI RAATTY 2 cut(s) 635, 652
AfaI GTAC 3 cut(s) 228, 308, 317
AhdI GACNNNNNGTC 1 cut(s) 403
Alw21I GWGCWC 1 cut(s) 38
Alw26I GTCTC 1 cut(s) 411
AlwI GGATC 8 cut(s) 150, 181, 186, 194, 245, 391, 507, 520
Ama87I CYCGRG 1 cut(s) 31
AoxI GGCC 2 cut(s) 210, 481
ApoI RAATTY 2 cut(s) 635, 652
AscI GGCGCGCC 1 cut(s) 501
AspLEI GCGC 2 cut(s) 503, 505
AspS9I GGNCC 2 cut(s) 210, 416
AsuC2I CCSGG 3 cut(s) 414, 520, 659
AsuHPI GGTGA 1 cut(s) 633
AsuII TTCGAA 1 cut(s) 321
AvaI CYCGRG 1 cut(s) 31
AvaII GGWCC 1 cut(s) 416
BamHI GGATCC 2 cut(s) 186, 512
Bbv12I GWGCWC 1 cut(s) 38
BceAI ACGGC 2 cut(s) 35, 197
BcnI CCSGG 3 cut(s) 414, 520, 659
BcoDI GTCTC 1 cut(s) 411
BfaI CTAG 1 cut(s) 473
BglII AGATCT 1 cut(s) 683
Bme1390I CCNGG 3 cut(s) 414, 520, 659
Bme18I GGWCC 1 cut(s) 416
BmeRI GACNNNNNGTC 1 cut(s) 403
BmeT110I CYCGRG 1 cut(s) 31
BmgT120I GGNCC 2 cut(s) 210, 416
BmiI GGNNCC 4 cut(s) 49, 188, 418, 514
BmrFI CCNGG 3 cut(s) 414, 520, 659
BmsI GCATC 1 cut(s) 112
Bpu14I TTCGAA 1 cut(s) 321
BpuEI CTTGAG 1 cut(s) 378
BpuMI CCSGG 3 cut(s) 414, 520, 659
BsaBI GATNNNNATC 1 cut(s) 468
BsaI GGTCTC 1 cut(s) 411
BsaJI CCNNGG 1 cut(s) 658
Bse118I RCCGGY 1 cut(s) 505
Bse3DI GCAATG 1 cut(s) 49
Bse8I GATNNNNATC 1 cut(s) 468
BseDI CCNNGG 1 cut(s) 658
BseJI GATNNNNATC 1 cut(s) 468
BseMI GCAATG 1 cut(s) 49
BsePI GCGCGC 1 cut(s) 501
Bsh1236I CGCG 1 cut(s) 503
Bsh1285I CGRYCG 1 cut(s) 390
BshFI GGCC 2 cut(s) 212, 483
BsiEI CGRYCG 1 cut(s) 390
BsiHKAI GWGCWC 1 cut(s) 38
BsiHKCI CYCGRG 1 cut(s) 31
BsiSI CCGG 5 cut(s) 381, 414, 506, 520, 658
BsmAI GTCTC 1 cut(s) 411
BsnI GGCC 2 cut(s) 212, 483
Bso31I GGTCTC 1 cut(s) 411
BsoBI CYCGRG 1 cut(s) 31
Bsp119I TTCGAA 1 cut(s) 321
Bsp1286I GDGCHC 1 cut(s) 38
Bsp1407I TGTACA 1 cut(s) 306
BspANI GGCC 2 cut(s) 212, 483
BspFNI CGCG 1 cut(s) 503
BspLI GGNNCC 4 cut(s) 49, 188, 418, 514
BspPI GGATC 8 cut(s) 150, 181, 186, 194, 245, 391, 507, 520
BspT104I TTCGAA 1 cut(s) 321
BspTNI GGTCTC 1 cut(s) 411
BsrDI GCAATG 1 cut(s) 49
BsrFI RCCGGY 1 cut(s) 505
BsrGI TGTACA 1 cut(s) 306
BssAI RCCGGY 1 cut(s) 505
BssECI CCNNGG 1 cut(s) 658
BssHII GCGCGC 1 cut(s) 501
Bst4CI ACNGT 1 cut(s) 59
BstAUI TGTACA 1 cut(s) 306
BstBI TTCGAA 1 cut(s) 321
BstC8I GCNNGC 2 cut(s) 503, 666
BstDEI CTNAG 1 cut(s) 233
BstFNI CGCG 1 cut(s) 503
BstHHI GCGC 2 cut(s) 503, 505
BstMAI GTCTC 1 cut(s) 411
BstMCI CGRYCG 1 cut(s) 390
BstNSI RCATGY 1 cut(s) 668
BstSCI CCNGG 3 cut(s) 412, 518, 657
BstUI CGCG 1 cut(s) 503
BstX2I RGATCY 4 cut(s) 186, 250, 512, 683
BstYI RGATCY 4 cut(s) 186, 250, 512, 683
BsuRI GGCC 2 cut(s) 212, 483
BtsIMutI CAGTG 1 cut(s) 131
Cac8I GCNNGC 2 cut(s) 503, 666
CfoI GCGC 2 cut(s) 503, 505
Cfr10I RCCGGY 1 cut(s) 505
Cfr13I GGNCC 2 cut(s) 210, 416
CseI GACGC 1 cut(s) 516
Csp6I GTAC 3 cut(s) 227, 307, 316
CviAII CATG 5 cut(s) 182, 282, 337, 479, 665
CviJI RGCY 3 cut(s) 50, 212, 483
CviKI_1 RGCY 3 cut(s) 50, 212, 483
CviQI GTAC 3 cut(s) 227, 307, 316
DdeI CTNAG 1 cut(s) 233
DriI GACNNNNNGTC 1 cut(s) 403
Eam1105I GACNNNNNGTC 1 cut(s) 403
Eco31I GGTCTC 1 cut(s) 411
Eco47I GGWCC 1 cut(s) 416
Eco88I CYCGRG 1 cut(s) 31
FaeI CATG 5 cut(s) 185, 285, 340, 482, 668
FatI CATG 5 cut(s) 181, 281, 336, 478, 664
FblI GTMKAC 2 cut(s) 54, 530
FspBI CTAG 1 cut(s) 473
GlaI GCGC 2 cut(s) 502, 504
HaeIII GGCC 2 cut(s) 212, 483
HapII CCGG 5 cut(s) 381, 414, 506, 520, 658
HgaI GACGC 1 cut(s) 516
HhaI GCGC 2 cut(s) 503, 505
Hin1II CATG 5 cut(s) 185, 285, 340, 482, 668
Hin6I GCGC 2 cut(s) 501, 503
HinP1I GCGC 2 cut(s) 501, 503
HinfI GANTC 4 cut(s) 118, 450, 464, 646
HpaII CCGG 5 cut(s) 381, 414, 506, 520, 658
HphI GGTGA 1 cut(s) 633
Hpy166II GTNNAC 2 cut(s) 55, 531
Hpy188I TCNGA 2 cut(s) 201, 469
Hpy188III TCNNGA 2 cut(s) 176, 395
Hpy8I GTNNAC 2 cut(s) 55, 531
HpyAV CCTTC 2 cut(s) 201, 491
HpyCH4III ACNGT 1 cut(s) 59
HpyCH4V TGCA 1 cut(s) 218
HpyF3I CTNAG 1 cut(s) 233
Hsp92II CATG 5 cut(s) 185, 285, 340, 482, 668
HspAI GCGC 2 cut(s) 501, 503
LmnI GCTCC 3 cut(s) 47, 248, 583
LpnPI CCDG 6 cut(s) 161, 394, 427, 519, 533, 671
LweI GCATC 1 cut(s) 112
MaeI CTAG 1 cut(s) 473
MaeIII GTNAC 1 cut(s) 284
MboII GAAGA 3 cut(s) 283, 286, 352
MflI RGATCY 4 cut(s) 186, 250, 512, 683
MhlI GDGCHC 1 cut(s) 38
MluCI AATT 7 cut(s) 85, 124, 238, 344, 626, 635, 652
MlyI GAGTC 2 cut(s) 444, 640
MnlI CCTC 2 cut(s) 283, 526
MseI TTAA 2 cut(s) 347, 694
MspI CCGG 5 cut(s) 381, 414, 506, 520, 658
MspR9I CCNGG 3 cut(s) 414, 520, 659
MvnI CGCG 1 cut(s) 503
NciI CCSGG 3 cut(s) 414, 520, 659
NlaIII CATG 5 cut(s) 185, 285, 340, 482, 668
NlaIV GGNNCC 4 cut(s) 49, 188, 418, 514
NmeAIII GCCGAG 1 cut(s) 667
NspI RCATGY 1 cut(s) 668
NspV TTCGAA 1 cut(s) 321
PaeI GCATGC 1 cut(s) 668
PalAI GGCGCGCC 1 cut(s) 501
PauI GCGCGC 1 cut(s) 501
PfeI GAWTC 2 cut(s) 118, 464
PflFI GACNNNGTC 1 cut(s) 526
PfoI TCCNGGA 1 cut(s) 518
PleI GAGTC 2 cut(s) 444, 640
PpsI GAGTC 2 cut(s) 444, 640
PspN4I GGNNCC 4 cut(s) 49, 188, 418, 514
PspPI GGNCC 2 cut(s) 210, 416
PsrI GAACNNNNNNTAC 2 cut(s) 156, 188
PsuI RGATCY 4 cut(s) 186, 250, 512, 683
PsyI GACNNNGTC 1 cut(s) 526
PteI GCGCGC 1 cut(s) 501
RsaI GTAC 3 cut(s) 228, 308, 317
RsaNI GTAC 3 cut(s) 227, 307, 316
SaqAI TTAA 2 cut(s) 347, 694
Sau96I GGNCC 2 cut(s) 210, 416
SchI GAGTC 2 cut(s) 444, 640
ScrFI CCNGG 3 cut(s) 414, 520, 659
SduI GDGCHC 1 cut(s) 38
SetI ASST 2 cut(s) 402, 544
SfaNI GCATC 1 cut(s) 112
SfuI TTCGAA 1 cut(s) 321
SgrAI CRCCGGYG 1 cut(s) 505
SgsI GGCGCGCC 1 cut(s) 501
SinI GGWCC 1 cut(s) 416
SmlI CTYRAG 1 cut(s) 393
SmoI CTYRAG 1 cut(s) 393
SphI GCATGC 1 cut(s) 668
Sse9I AATT 7 cut(s) 85, 124, 238, 344, 626, 635, 652
SspMI CTAG 1 cut(s) 473
StyD4I CCNGG 3 cut(s) 412, 518, 657
TaaI ACNGT 1 cut(s) 59
TaqI TCGA 1 cut(s) 321
TaqII GACCGA 1 cut(s) 376
TasI AATT 7 cut(s) 85, 124, 238, 344, 626, 635, 652
TatI WGTACW 2 cut(s) 226, 306
TfiI GAWTC 2 cut(s) 118, 464
Tru1I TTAA 2 cut(s) 347, 694
Tru9I TTAA 2 cut(s) 347, 694
TscAI CASTG 1 cut(s) 138
TspDTI ATGAA 4 cut(s) 284, 353, 438, 467
TspGWI ACGGA 1 cut(s) 591
TspRI CASTG 1 cut(s) 138
Tth111I GACNNNGTC 1 cut(s) 526
VpaK11BI GGWCC 1 cut(s) 416
XapI RAATTY 2 cut(s) 635, 652
XceI RCATGY 1 cut(s) 668
XmiI GTMKAC 2 cut(s) 54, 530
XspI CTAG 1 cut(s) 473
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.