Rh1CG032300

function. Its presence in a non-photosynthetic plant (Epifagus virginiana) and experiments in tobacco indicate that it has an essential function which is probably not related to photosynthesis

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1C
OG0004273
Physical Location & Seq
Reverse (-)
6286358 .. 6287703
1346 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1CG032300.1

Sequence Viewer

Length: 807 bp
ATGATTCATCGAAATAATGAGTCACCATTGATATCGACACATCTGAGATCGCCAAATATTCGGGAGTTCCTCTATTCAATCCTTTTCCTTCTTCTTATTGCTGGATATCTCGTTCGTACACATCTTCTCTTTGTTTCTCGAGCCTATAGTGAGTTACAGACAGAGTTCGAAAGGGTCAAATCTTTGATGATTCCATCATCCATGATTAAGTTGCGAAAACTTCTGGATAGGTATCCTCCATCTGAACTGAATTCTTTCTGGTTAAAGAATCTCTTTCTAGTTGCTGTGGAACAATTAGGAGATTCTCTAGAAGAAATACGGGGTTCCGCTTCTGGCGGCAACATGCTATGGGGTGGTGGTCCCGCTTATGGGGTCAAATCAATACGTTCTAAGAAGAAATATTTGAATATAAATCTCATCGATATCATCGATTTCATAAGTATCATACCAAATCCCATCAATCGAATCGCTTTTTCGAGAAATACGAGACATCTAAGTCATACAAGTAAAGAGATCTATTCATTGATAAGAAAAAGAAAAAACGTGAACGGTGATTGGATTGACGATAAAATAGAATCATGGGTCTCGAACAGTGATTCGATTGGTGATAAAGAAAGAGAATTCTTGGTTCAGTTCTCCACCTTAACGACAGAAAAAAGGATTGATCAAATTCTATTGAGTCTGACTCATAGTGATCATTTATCAAAGAATGACTCTGGTTATCAAATGATTGAACAACCGGGAGCAATTTACTTACGATACTTAGTTGACATTCATAAAAATGAACTATCTCTCCAGGGATTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AAA DUF825

Protein Analysis

268

Amino Acids

30.89

Weight (kDa)

9.26

Isoelectric Point (pI)

45.99

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ycf2 PF05695 1 - 169 1.4e-101 Ycf2 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 495
AciI CCGC 3 cut(s) 327, 336, 363
AcsI RAATTY 3 cut(s) 250, 620, 669
AfaI GTAC 1 cut(s) 118
AfiI CCNNNNNNNGG 2 cut(s) 368, 369
AgsI TTSAA 3 cut(s) 78, 406, 734
AjnI CCWGG 1 cut(s) 795
AloI GAACNNNNNNTCC 3 cut(s) 96, 128, 777
Alw26I GTCTC 2 cut(s) 481, 589
Ama87I CYCGRG 1 cut(s) 138
ApoI RAATTY 3 cut(s) 250, 620, 669
Asp700I GAANNNNTTC 1 cut(s) 254
AspS9I GGNCC 1 cut(s) 359
AsuC2I CCSGG 1 cut(s) 741
AsuHPI GGTGA 3 cut(s) 15, 563, 617
AsuII TTCGAA 1 cut(s) 168
AvaI CYCGRG 1 cut(s) 138
AvaII GGWCC 1 cut(s) 359
BccI CCATC 3 cut(s) 202, 247, 464
BciT130I CCWGG 1 cut(s) 797
BciVI GTATCC 1 cut(s) 243
BclI TGATCA 2 cut(s) 664, 694
BcnI CCSGG 1 cut(s) 741
BcoDI GTCTC 2 cut(s) 481, 589
BfaI CTAG 2 cut(s) 278, 308
BfmI CTRYAG 1 cut(s) 145
BfuI GTATCC 1 cut(s) 243
BglII AGATCT 1 cut(s) 513
BisI GCNGC 1 cut(s) 337
BlsI GCNGC 1 cut(s) 338
Bme1390I CCNGG 2 cut(s) 741, 797
Bme18I GGWCC 1 cut(s) 359
BmeT110I CYCGRG 1 cut(s) 138
BmgT120I GGNCC 1 cut(s) 359
BmiI GGNNCC 2 cut(s) 325, 361
BmrFI CCNGG 2 cut(s) 741, 797
BplI GAGNNNNNCTC 2 cut(s) 670, 702
BpmI CTGGAG 1 cut(s) 779
Bpu14I TTCGAA 1 cut(s) 168
BpuMI CCSGG 1 cut(s) 741
Bsa29I ATCGAT 2 cut(s) 420, 429
BsaBI GATNNNNATC 1 cut(s) 231
BsaI GGTCTC 1 cut(s) 589
BsaJI CCNNGG 1 cut(s) 796
BsaXI ACNNNNNCTCC 2 cut(s) 777, 807
Bsc4I CCNNNNNNNGG 2 cut(s) 368, 369
Bse8I GATNNNNATC 1 cut(s) 231
BseBI CCWGG 1 cut(s) 797
BseCI ATCGAT 2 cut(s) 420, 429
BseDI CCNNGG 1 cut(s) 796
BseGI GGATG 1 cut(s) 197
BseJI GATNNNNATC 1 cut(s) 231
BseLI CCNNNNNNNGG 2 cut(s) 368, 369
BseMII CTCAG 1 cut(s) 35
BshVI ATCGAT 2 cut(s) 420, 429
BsiHKCI CYCGRG 1 cut(s) 138
BsiSI CCGG 1 cut(s) 740
BslFI GGGAC 1 cut(s) 345
BslI CCNNNNNNNGG 2 cut(s) 368, 369
BsmAI GTCTC 2 cut(s) 481, 589
BsmFI GGGAC 1 cut(s) 345
Bso31I GGTCTC 1 cut(s) 589
BsoBI CYCGRG 1 cut(s) 138
Bsp119I TTCGAA 1 cut(s) 168
Bsp143I GATC 4 cut(s) 47, 513, 664, 694
BspACI CCGC 3 cut(s) 327, 336, 363
BspCNI CTCAG 1 cut(s) 36
BspDI ATCGAT 2 cut(s) 420, 429
BspLI GGNNCC 2 cut(s) 325, 361
BspT104I TTCGAA 1 cut(s) 168
BspTNI GGTCTC 1 cut(s) 589
BssECI CCNNGG 1 cut(s) 796
BssMI GATC 4 cut(s) 47, 513, 664, 694
Bst2UI CCWGG 1 cut(s) 797
Bst4CI ACNGT 2 cut(s) 551, 593
BstBI TTCGAA 1 cut(s) 168
BstDEI CTNAG 4 cut(s) 44, 390, 494, 763
BstF5I GGATG 1 cut(s) 197
BstKTI GATC 4 cut(s) 50, 516, 667, 697
BstMAI GTCTC 2 cut(s) 481, 589
BstMBI GATC 4 cut(s) 47, 513, 664, 694
BstNI CCWGG 1 cut(s) 797
BstNSI RCATGY 1 cut(s) 346
BstSCI CCNGG 2 cut(s) 739, 795
BstSFI CTRYAG 1 cut(s) 145
BstX2I RGATCY 1 cut(s) 513
BstYI RGATCY 1 cut(s) 513
Bsu15I ATCGAT 2 cut(s) 420, 429
BsuI GTATCC 1 cut(s) 243
BsuTUI ATCGAT 2 cut(s) 420, 429
BtsCI GGATG 1 cut(s) 197
BtsIMutI CAGTG 1 cut(s) 598
Cfr13I GGNCC 1 cut(s) 359
ClaI ATCGAT 2 cut(s) 420, 429
Csp6I GTAC 1 cut(s) 117
CviAII CATG 3 cut(s) 202, 343, 579
CviJI RGCY 1 cut(s) 143
CviKI_1 RGCY 1 cut(s) 143
CviQI GTAC 1 cut(s) 117
DdeI CTNAG 4 cut(s) 44, 390, 494, 763
DpnI GATC 4 cut(s) 49, 515, 666, 696
DpnII GATC 4 cut(s) 47, 513, 664, 694
DrdI GACNNNNNNGTC 1 cut(s) 495
DseDI GACNNNNNNGTC 1 cut(s) 495
Eco31I GGTCTC 1 cut(s) 589
Eco32I GATATC 3 cut(s) 33, 107, 424
Eco47I GGWCC 1 cut(s) 359
Eco88I CYCGRG 1 cut(s) 138
EcoRI GAATTC 2 cut(s) 250, 620
EcoRII CCWGG 1 cut(s) 795
EcoRV GATATC 3 cut(s) 33, 107, 424
FaeI CATG 3 cut(s) 205, 346, 582
FalI AAGNNNNNCTT 2 cut(s) 257, 289
FaqI GGGAC 1 cut(s) 345
FatI CATG 3 cut(s) 201, 342, 578
FauI CCCGC 1 cut(s) 370
FbaI TGATCA 2 cut(s) 664, 694
Fnu4HI GCNGC 1 cut(s) 337
FokI GGATG 1 cut(s) 184
Fsp4HI GCNGC 1 cut(s) 337
FspBI CTAG 2 cut(s) 278, 308
GluI GCNGC 1 cut(s) 337
GsuI CTGGAG 1 cut(s) 779
HapII CCGG 1 cut(s) 740
Hin1II CATG 3 cut(s) 205, 346, 582
HincII GTYRAC 1 cut(s) 769
HindII GTYRAC 1 cut(s) 769
HpaII CCGG 1 cut(s) 740
HphI GGTGA 3 cut(s) 15, 563, 617
Hpy166II GTNNAC 3 cut(s) 119, 547, 769
Hpy188I TCNGA 3 cut(s) 45, 244, 684
Hpy188III TCNNGA 6 cut(s) 62, 138, 224, 308, 477, 586
Hpy8I GTNNAC 3 cut(s) 119, 547, 769
HpyAV CCTTC 1 cut(s) 98
HpyCH4III ACNGT 2 cut(s) 551, 593
HpyCH4IV ACGT 2 cut(s) 385, 543
HpyF3I CTNAG 4 cut(s) 44, 390, 494, 763
HpySE526I ACGT 2 cut(s) 385, 543
Hsp92II CATG 3 cut(s) 205, 346, 582
Ksp22I TGATCA 2 cut(s) 664, 694
Kzo9I GATC 4 cut(s) 47, 513, 664, 694
LmnI GCTCC 1 cut(s) 743
LpnPI CCDG 7 cut(s) 87, 209, 244, 318, 702, 753, 782
MaeI CTAG 2 cut(s) 278, 308
MaeII ACGT 2 cut(s) 385, 543
MaeIII GTNAC 2 cut(s) 21, 153
MalI GATC 4 cut(s) 49, 515, 666, 696
MboI GATC 4 cut(s) 47, 513, 664, 694
MboII GAAGA 4 cut(s) 83, 116, 323, 406
MflI RGATCY 1 cut(s) 513
MluCI AATT 5 cut(s) 250, 293, 620, 669, 747
MlyI GAGTC 4 cut(s) 29, 679, 688, 707
MnlI CCTC 2 cut(s) 80, 246
MroXI GAANNNNTTC 1 cut(s) 254
MseI TTAA 3 cut(s) 207, 263, 644
MslI CAYNNNNRTG 1 cut(s) 780
MspI CCGG 1 cut(s) 740
MspR9I CCNGG 2 cut(s) 741, 797
MvaI CCWGG 1 cut(s) 797
NciI CCSGG 1 cut(s) 741
NdeII GATC 4 cut(s) 47, 513, 664, 694
NlaIII CATG 3 cut(s) 205, 346, 582
NlaIV GGNNCC 2 cut(s) 325, 361
NmuCI GTSAC 1 cut(s) 21
NspI RCATGY 1 cut(s) 346
NspV TTCGAA 1 cut(s) 168
PaeR7I CTCGAG 1 cut(s) 138
PcsI WCGNNNNNNNCGW 2 cut(s) 426, 482
PdmI GAANNNNTTC 1 cut(s) 254
PfeI GAWTC 7 cut(s) 4, 190, 268, 302, 465, 575, 596
PkrI GCNGC 1 cut(s) 338
PleI GAGTC 4 cut(s) 28, 679, 687, 707
PpsI GAGTC 4 cut(s) 28, 679, 687, 707
Psp6I CCWGG 1 cut(s) 795
PspGI CCWGG 1 cut(s) 795
PspN4I GGNNCC 2 cut(s) 325, 361
PspPI GGNCC 1 cut(s) 359
PsuI RGATCY 1 cut(s) 513
RsaI GTAC 1 cut(s) 118
RsaNI GTAC 1 cut(s) 117
RseI CAYNNNNRTG 1 cut(s) 780
SaqAI TTAA 3 cut(s) 207, 263, 644
SatI GCNGC 1 cut(s) 337
Sau3AI GATC 4 cut(s) 47, 513, 664, 694
Sau96I GGNCC 1 cut(s) 359
SchI GAGTC 4 cut(s) 29, 679, 688, 707
ScrFI CCNGG 2 cut(s) 741, 797
SetI ASST 4 cut(s) 233, 388, 546, 644
SfcI CTRYAG 1 cut(s) 145
Sfr274I CTCGAG 1 cut(s) 138
SfuI TTCGAA 1 cut(s) 168
SinI GGWCC 1 cut(s) 359
SlaI CTCGAG 1 cut(s) 138
SmiMI CAYNNNNRTG 1 cut(s) 780
SmlI CTYRAG 1 cut(s) 138
SmoI CTYRAG 1 cut(s) 138
Sse9I AATT 5 cut(s) 250, 293, 620, 669, 747
SsiI CCGC 3 cut(s) 327, 336, 363
SspI AATATT 2 cut(s) 58, 401
SspMI CTAG 2 cut(s) 278, 308
StyD4I CCNGG 2 cut(s) 739, 795
TaaI ACNGT 2 cut(s) 551, 593
TaiI ACGT 2 cut(s) 388, 546
TasI AATT 5 cut(s) 250, 293, 620, 669, 747
TauI GCSGC 1 cut(s) 339
TfiI GAWTC 7 cut(s) 4, 190, 268, 302, 465, 575, 596
Tru1I TTAA 3 cut(s) 207, 263, 644
Tru9I TTAA 3 cut(s) 207, 263, 644
TscAI CASTG 1 cut(s) 598
TseFI GTSAC 1 cut(s) 21
Tsp45I GTSAC 1 cut(s) 21
TspDTI ATGAA 4 cut(s) 424, 510, 764, 798
TspRI CASTG 1 cut(s) 598
VpaK11BI GGWCC 1 cut(s) 359
XapI RAATTY 3 cut(s) 250, 620, 669
XbaI TCTAGA 1 cut(s) 307
XceI RCATGY 1 cut(s) 346
XhoI CTCGAG 1 cut(s) 138
XmnI GAANNNNTTC 1 cut(s) 254
XspI CTAG 2 cut(s) 278, 308
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.