pycom16g20490

function. Its presence in a non-photosynthetic plant (Epifagus virginiana) and experiments in tobacco indicate that it has an essential function which is probably not related to photosynthesis

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
Physical Location & Seq
Reverse (-)
18251765 .. 18252211
447 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom16g20490.3

Sequence Viewer

Length: 300 bp
ATGATATATGAGTTAATATATTTGCGAGATCCGGTAGCACTTATCAATGAGGATTTGCGATTCCAAGTTAGATTGGTTCAGAATCATGGTATCCTTTTCTATGAGATAGAAAGGACTGTTGTACAAAATCTACTTTTAAGTAATTGCTCCATAGATCCAACATCTATCTATATAAAGAAGAAATCATGTAACAAAGGAGATTCTCATTTTTGTTTTGCCGGATCGGTTGCTCAAGACCTTTGGTTTGTATCCCGATCTGTAGTTGAAAATATTATAAAATTAGTATATGTCCCTCAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

100

Amino Acids

11.48

Weight (kDa)

6.7

Isoelectric Point (pI)

46.26

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 275
AclWI GGATC 3 cut(s) 23, 149, 229
AfaI GTAC 1 cut(s) 123
AgsI TTSAA 1 cut(s) 266
AlwI GGATC 3 cut(s) 23, 149, 229
ArsI GACNNNNNNTTYG 2 cut(s) 227, 259
BciVI GTATCC 2 cut(s) 101, 259
BfmI CTRYAG 1 cut(s) 258
BfuI GTATCC 2 cut(s) 101, 259
BpuEI CTTGAG 1 cut(s) 216
BsaWI WCCGGW 1 cut(s) 31
BsiSI CCGG 2 cut(s) 32, 219
BslFI GGGAC 1 cut(s) 275
BsmFI GGGAC 1 cut(s) 275
Bsp1407I TGTACA 1 cut(s) 121
Bsp143I GATC 4 cut(s) 28, 154, 221, 254
BspPI GGATC 3 cut(s) 23, 149, 229
BsrGI TGTACA 1 cut(s) 121
BssMI GATC 4 cut(s) 28, 154, 221, 254
Bst4CI ACNGT 1 cut(s) 118
BstAUI TGTACA 1 cut(s) 121
BstKTI GATC 4 cut(s) 31, 157, 224, 257
BstMBI GATC 4 cut(s) 28, 154, 221, 254
BstSFI CTRYAG 1 cut(s) 258
BstX2I RGATCY 2 cut(s) 28, 154
BstYI RGATCY 2 cut(s) 28, 154
BsuI GTATCC 2 cut(s) 101, 259
Csp6I GTAC 1 cut(s) 122
CviAII CATG 2 cut(s) 86, 186
CviQI GTAC 1 cut(s) 122
DpnI GATC 4 cut(s) 30, 156, 223, 256
DpnII GATC 4 cut(s) 28, 154, 221, 254
FaeI CATG 2 cut(s) 89, 189
FaqI GGGAC 1 cut(s) 275
FatI CATG 2 cut(s) 85, 185
HapII CCGG 2 cut(s) 32, 219
Hin1II CATG 2 cut(s) 89, 189
HinfI GANTC 3 cut(s) 60, 82, 200
HpaII CCGG 2 cut(s) 32, 219
Hpy188I TCNGA 1 cut(s) 81
Hpy188III TCNNGA 2 cut(s) 233, 252
HpyCH4III ACNGT 1 cut(s) 118
Hsp92II CATG 2 cut(s) 89, 189
Kzo9I GATC 4 cut(s) 28, 154, 221, 254
LmnI GCTCC 1 cut(s) 152
LpnPI CCDG 2 cut(s) 45, 232
MaeIII GTNAC 1 cut(s) 188
MalI GATC 4 cut(s) 30, 156, 223, 256
MboI GATC 4 cut(s) 28, 154, 221, 254
MboII GAAGA 1 cut(s) 190
MflI RGATCY 2 cut(s) 28, 154
MluCI AATT 2 cut(s) 142, 278
MmeI TCCRAC 1 cut(s) 182
MnlI CCTC 1 cut(s) 43
MseI TTAA 2 cut(s) 14, 137
MspI CCGG 2 cut(s) 32, 219
NdeII GATC 4 cut(s) 28, 154, 221, 254
NlaIII CATG 2 cut(s) 89, 189
PfeI GAWTC 3 cut(s) 60, 82, 200
PsiI TTATAA 1 cut(s) 275
PsuI RGATCY 2 cut(s) 28, 154
RsaI GTAC 1 cut(s) 123
RsaNI GTAC 1 cut(s) 122
SaqAI TTAA 2 cut(s) 14, 137
Sau3AI GATC 4 cut(s) 28, 154, 221, 254
SetI ASST 1 cut(s) 240
SfcI CTRYAG 1 cut(s) 258
SgeI CNNG 8 cut(s) 38, 44, 77, 98, 198, 231, 245, 264
SmlI CTYRAG 1 cut(s) 231
SmoI CTYRAG 1 cut(s) 231
Sse9I AATT 2 cut(s) 142, 278
SspI AATATT 1 cut(s) 271
TaaI ACNGT 1 cut(s) 118
TasI AATT 2 cut(s) 142, 278
TatI WGTACW 1 cut(s) 121
TfiI GAWTC 3 cut(s) 60, 82, 200
Tru1I TTAA 2 cut(s) 14, 137
Tru9I TTAA 2 cut(s) 14, 137
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.