pycom16g20550

function. Its presence in a non-photosynthetic plant (Epifagus virginiana) and experiments in tobacco indicate that it has an essential function which is probably not related to photosynthesis

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr16
Physical Location & Seq
Reverse (-)
18284439 .. 18284735
297 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom16g20550.2

Sequence Viewer

Length: 216 bp
ATGATATATGAGTTAATATATTTGCGAGATCTGGTAGCACTTATCAATGAGGATTTGCGATTCCAAGTTAGATTGGTTCAGAATCATGGTATCCTTTTCTATGAGATAGGAAGGACTGTTGTACAAAATCTACTTTTAAGTAATTGCTCCATAGATCCAACATCTATCTATATAAAGAAGAAATCATGTAACAAAGGAGTTTCTCATTTGCACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

72

Amino Acids

8.26

Weight (kDa)

8.69

Isoelectric Point (pI)

27.3

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 149
AfaI GTAC 1 cut(s) 123
AlwI GGATC 1 cut(s) 149
BciVI GTATCC 1 cut(s) 101
BfuI GTATCC 1 cut(s) 101
BglII AGATCT 1 cut(s) 28
Bsp1407I TGTACA 1 cut(s) 121
Bsp143I GATC 2 cut(s) 28, 154
BspPI GGATC 1 cut(s) 149
BsrGI TGTACA 1 cut(s) 121
BssMI GATC 2 cut(s) 28, 154
Bst4CI ACNGT 1 cut(s) 118
BstAUI TGTACA 1 cut(s) 121
BstKTI GATC 2 cut(s) 31, 157
BstMBI GATC 2 cut(s) 28, 154
BstX2I RGATCY 2 cut(s) 28, 154
BstYI RGATCY 2 cut(s) 28, 154
BsuI GTATCC 1 cut(s) 101
Csp6I GTAC 1 cut(s) 122
CviAII CATG 2 cut(s) 86, 186
CviQI GTAC 1 cut(s) 122
DpnI GATC 2 cut(s) 30, 156
DpnII GATC 2 cut(s) 28, 154
FaeI CATG 2 cut(s) 89, 189
FaiI YATR 9 cut(s) 7, 9, 19, 87, 102, 152, 171, 173, 187
FatI CATG 2 cut(s) 85, 185
Hin1II CATG 2 cut(s) 89, 189
HinfI GANTC 2 cut(s) 60, 82
Hpy188I TCNGA 1 cut(s) 81
HpyAV CCTTC 1 cut(s) 105
HpyCH4III ACNGT 1 cut(s) 118
HpyCH4V TGCA 1 cut(s) 211
Hsp92II CATG 2 cut(s) 89, 189
Kzo9I GATC 2 cut(s) 28, 154
LmnI GCTCC 1 cut(s) 152
LpnPI CCDG 1 cut(s) 17
MaeIII GTNAC 1 cut(s) 188
MalI GATC 2 cut(s) 30, 156
MboI GATC 2 cut(s) 28, 154
MboII GAAGA 1 cut(s) 190
MflI RGATCY 2 cut(s) 28, 154
MluCI AATT 1 cut(s) 142
MmeI TCCRAC 1 cut(s) 182
MnlI CCTC 1 cut(s) 43
MseI TTAA 2 cut(s) 14, 137
NdeII GATC 2 cut(s) 28, 154
NlaIII CATG 2 cut(s) 89, 189
PfeI GAWTC 2 cut(s) 60, 82
PsuI RGATCY 2 cut(s) 28, 154
RsaI GTAC 1 cut(s) 123
RsaNI GTAC 1 cut(s) 122
SaqAI TTAA 2 cut(s) 14, 137
Sau3AI GATC 2 cut(s) 28, 154
SgeI CNNG 5 cut(s) 38, 44, 77, 98, 198
Sse9I AATT 1 cut(s) 142
TaaI ACNGT 1 cut(s) 118
TasI AATT 1 cut(s) 142
TatI WGTACW 1 cut(s) 121
TfiI GAWTC 2 cut(s) 60, 82
Tru1I TTAA 2 cut(s) 14, 137
Tru9I TTAA 2 cut(s) 14, 137
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.