RCHIOBHM_CPG0501831

30S ribosomal protein S19

Basic Information

Type: gene
Biological Identity
rosa_chinensis
Pt
Physical Location & Seq
Forward (+)
27379 .. 27620
242 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ15676

Sequence Viewer

Length: 150 bp
ATGATCGGGCATACTATTGCTATCCATAATGGAAGGGAGCATTTGCCTATTTATATAACAGATCGTATGGTAGGACATAAATTGGGAGAATTTTCACCGACTCTAAATTTCCGGGGGCATGCGAAAGGTGATAATAGATCTCGGCGTTAA

Protein Analysis

49

Amino Acids

5.61

Weight (kDa)

10.83

Isoelectric Point (pI)

40.24

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_S19 PF00203 1 - 40 2.1e-18 Ribosomal protein S19
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 89, 106
ApoI RAATTY 2 cut(s) 89, 106
AsuC2I CCSGG 1 cut(s) 113
AsuHPI GGTGA 2 cut(s) 87, 140
BcnI CCSGG 1 cut(s) 113
BglII AGATCT 1 cut(s) 137
Bme1390I CCNGG 1 cut(s) 113
BmrFI CCNGG 1 cut(s) 113
BpuMI CCSGG 1 cut(s) 113
BsaJI CCNNGG 1 cut(s) 112
BseDI CCNNGG 1 cut(s) 112
BsiSI CCGG 1 cut(s) 112
Bsp143I GATC 3 cut(s) 3, 61, 137
BssECI CCNNGG 1 cut(s) 112
BssMI GATC 3 cut(s) 3, 61, 137
BstC8I GCNNGC 1 cut(s) 120
BstKTI GATC 3 cut(s) 6, 64, 140
BstMBI GATC 3 cut(s) 3, 61, 137
BstNSI RCATGY 1 cut(s) 122
BstSCI CCNGG 1 cut(s) 111
BstX2I RGATCY 1 cut(s) 137
BstYI RGATCY 1 cut(s) 137
Cac8I GCNNGC 1 cut(s) 120
CviAII CATG 1 cut(s) 119
DpnI GATC 3 cut(s) 5, 63, 139
DpnII GATC 3 cut(s) 3, 61, 137
FaeI CATG 1 cut(s) 122
FaiI YATR 7 cut(s) 12, 27, 54, 56, 68, 78, 120
FatI CATG 1 cut(s) 118
HapII CCGG 1 cut(s) 112
Hin1II CATG 1 cut(s) 122
HinfI GANTC 1 cut(s) 100
HpaII CCGG 1 cut(s) 112
HphI GGTGA 2 cut(s) 87, 140
HpyAV CCTTC 1 cut(s) 27
Hsp92II CATG 1 cut(s) 122
Kzo9I GATC 3 cut(s) 3, 61, 137
LmnI GCTCC 1 cut(s) 37
LpnPI CCDG 1 cut(s) 125
MalI GATC 3 cut(s) 5, 63, 139
MboI GATC 3 cut(s) 3, 61, 137
MflI RGATCY 1 cut(s) 137
MluCI AATT 3 cut(s) 80, 89, 106
MlyI GAGTC 1 cut(s) 94
MseI TTAA 1 cut(s) 148
MspI CCGG 1 cut(s) 112
MspR9I CCNGG 1 cut(s) 113
NciI CCSGG 1 cut(s) 113
NdeII GATC 3 cut(s) 3, 61, 137
NlaIII CATG 1 cut(s) 122
NmeAIII GCCGAG 1 cut(s) 121
NspI RCATGY 1 cut(s) 122
PaeI GCATGC 1 cut(s) 122
PleI GAGTC 1 cut(s) 94
PpsI GAGTC 1 cut(s) 94
PsuI RGATCY 1 cut(s) 137
SaqAI TTAA 1 cut(s) 148
Sau3AI GATC 3 cut(s) 3, 61, 137
SchI GAGTC 1 cut(s) 94
ScrFI CCNGG 1 cut(s) 113
SetI ASST 1 cut(s) 130
SgeI CNNG 4 cut(s) 19, 124, 125, 131
SphI GCATGC 1 cut(s) 122
Sse9I AATT 3 cut(s) 80, 89, 106
StyD4I CCNGG 1 cut(s) 111
TasI AATT 3 cut(s) 80, 89, 106
Tru1I TTAA 1 cut(s) 148
Tru9I TTAA 1 cut(s) 148
XapI RAATTY 2 cut(s) 89, 106
XceI RCATGY 1 cut(s) 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.