Rh1DG236200

function. Its presence in a non-photosynthetic plant (Epifagus virginiana) and experiments in tobacco indicate that it has an essential function which is probably not related to photosynthesis

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
OG0004273
Physical Location & Seq
Reverse (-)
44962629 .. 44962976
348 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG236200.1

Sequence Viewer

Length: 348 bp
ATGATAAGTGATATTTCGAGTAAGTGTTCACATAATCTTCTTCTGTCCGAAGAAATGATTCATCGAAATAATGAGTCACCATTGATATCGACACATCTGAGATCGCCAAATGTTCGGGAGTTCCTCTATTCAATCCTTTTCCTTCTTCTTATTGCTGGATATCTCGTTCGTACACATCTTCTTTTTGTTTCTCGAGCCTATAGTGAGTTACAGACAAAGTTCGAAAGGGTCAAATCTTTGATGATTCCATCATACATGATTGAGTTGCGAAAACTTCTGGATAGGTATCCTTCATCTGAACTAAATTCTTTCTGGTTAAAGAATCTCTTTCTAGTTGCTGTGGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AAA DUF825

Protein Analysis

115

Amino Acids

13.52

Weight (kDa)

8.82

Isoelectric Point (pI)

57.11

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ycf2 PF05695 1 - 115 7.8e-65 Ycf2 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 304
AfaI GTAC 1 cut(s) 172
AgsI TTSAA 1 cut(s) 132
AloI GAACNNNNNNTCC 2 cut(s) 150, 182
Ama87I CYCGRG 1 cut(s) 192
ApoI RAATTY 1 cut(s) 304
Asp700I GAANNNNTTC 1 cut(s) 57
AsuHPI GGTGA 1 cut(s) 69
AsuII TTCGAA 1 cut(s) 222
AvaI CYCGRG 1 cut(s) 192
BccI CCATC 1 cut(s) 256
BciVI GTATCC 1 cut(s) 297
BfaI CTAG 1 cut(s) 332
BfmI CTRYAG 1 cut(s) 199
BfuI GTATCC 1 cut(s) 297
BmeT110I CYCGRG 1 cut(s) 192
Bpu14I TTCGAA 1 cut(s) 222
BsaBI GATNNNNATC 1 cut(s) 285
Bse8I GATNNNNATC 1 cut(s) 285
BseJI GATNNNNATC 1 cut(s) 285
BseMII CTCAG 1 cut(s) 89
BsiHKCI CYCGRG 1 cut(s) 192
BsoBI CYCGRG 1 cut(s) 192
Bsp119I TTCGAA 1 cut(s) 222
Bsp143I GATC 1 cut(s) 101
BspCNI CTCAG 1 cut(s) 90
BspT104I TTCGAA 1 cut(s) 222
BssMI GATC 1 cut(s) 101
BstBI TTCGAA 1 cut(s) 222
BstDEI CTNAG 1 cut(s) 98
BstKTI GATC 1 cut(s) 104
BstMBI GATC 1 cut(s) 101
BstSFI CTRYAG 1 cut(s) 199
BsuI GTATCC 1 cut(s) 297
Csp6I GTAC 1 cut(s) 171
CviAII CATG 1 cut(s) 256
CviJI RGCY 1 cut(s) 197
CviKI_1 RGCY 1 cut(s) 197
CviQI GTAC 1 cut(s) 171
DdeI CTNAG 1 cut(s) 98
DpnI GATC 1 cut(s) 103
DpnII GATC 1 cut(s) 101
Eco32I GATATC 2 cut(s) 87, 161
Eco88I CYCGRG 1 cut(s) 192
EcoRV GATATC 2 cut(s) 87, 161
FaeI CATG 1 cut(s) 259
FaiI YATR 4 cut(s) 33, 201, 253, 257
FalI AAGNNNNNCTT 2 cut(s) 311, 343
FatI CATG 1 cut(s) 255
FspBI CTAG 1 cut(s) 332
Hin1II CATG 1 cut(s) 259
HinfI GANTC 4 cut(s) 58, 74, 244, 322
HphI GGTGA 1 cut(s) 69
Hpy166II GTNNAC 2 cut(s) 29, 173
Hpy188I TCNGA 3 cut(s) 49, 99, 298
Hpy188III TCNNGA 3 cut(s) 116, 192, 278
Hpy8I GTNNAC 2 cut(s) 29, 173
HpyAV CCTTC 2 cut(s) 152, 300
HpyF3I CTNAG 1 cut(s) 98
Hsp92II CATG 1 cut(s) 259
Kzo9I GATC 1 cut(s) 101
LpnPI CCDG 3 cut(s) 141, 263, 298
MaeI CTAG 1 cut(s) 332
MaeIII GTNAC 2 cut(s) 75, 207
MalI GATC 1 cut(s) 103
MboI GATC 1 cut(s) 101
MboII GAAGA 5 cut(s) 29, 32, 62, 137, 170
MluCI AATT 1 cut(s) 304
MlyI GAGTC 1 cut(s) 83
MnlI CCTC 1 cut(s) 134
MroXI GAANNNNTTC 1 cut(s) 57
MseI TTAA 1 cut(s) 317
NdeII GATC 1 cut(s) 101
NlaIII CATG 1 cut(s) 259
NmuCI GTSAC 1 cut(s) 75
NspV TTCGAA 1 cut(s) 222
PaeR7I CTCGAG 1 cut(s) 192
PdmI GAANNNNTTC 1 cut(s) 57
PfeI GAWTC 3 cut(s) 58, 244, 322
PleI GAGTC 1 cut(s) 82
PpsI GAGTC 1 cut(s) 82
RsaI GTAC 1 cut(s) 172
RsaNI GTAC 1 cut(s) 171
SaqAI TTAA 1 cut(s) 317
Sau3AI GATC 1 cut(s) 101
SchI GAGTC 1 cut(s) 83
SetI ASST 1 cut(s) 287
SfcI CTRYAG 1 cut(s) 199
Sfr274I CTCGAG 1 cut(s) 192
SfuI TTCGAA 1 cut(s) 222
SlaI CTCGAG 1 cut(s) 192
SmlI CTYRAG 1 cut(s) 192
SmoI CTYRAG 1 cut(s) 192
Sse9I AATT 1 cut(s) 304
SspMI CTAG 1 cut(s) 332
TaqI TCGA 5 cut(s) 17, 64, 89, 193, 222
TasI AATT 1 cut(s) 304
TfiI GAWTC 3 cut(s) 58, 244, 322
Tru1I TTAA 1 cut(s) 317
Tru9I TTAA 1 cut(s) 317
TseFI GTSAC 1 cut(s) 75
Tsp45I GTSAC 1 cut(s) 75
TspDTI ATGAA 2 cut(s) 50, 282
XapI RAATTY 1 cut(s) 304
XhoI CTCGAG 1 cut(s) 192
XmnI GAANNNNTTC 1 cut(s) 57
XspI CTAG 1 cut(s) 332
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.