Prupe.4G266600_v2.0.a1

30S ribosomal protein S19

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp04
Physical Location & Seq
Forward (+)
19922829 .. 19923181
353 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.4G266600.1

Sequence Viewer

Length: 219 bp
ATGAAAGGTACTCAGAGTTTTCTCGAGCATATCCTCCTAAGATCCCGAGCGTCTACCATTATACCTACAATGATCGGGCATACTATTGCTATCCATAATGGAAATGAGCATTTGCCTATTTATATAACGGATCATATGGTAGGACATAAATTGGGAGAATTTGCACATACTCTAAATTTTCGAGGGCATGCGAAAAATGATAATAGATCTCGTCGTTAA

Protein Analysis

73

Amino Acids

8.21

Weight (kDa)

10.4

Isoelectric Point (pI)

44.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 53
AclWI GGATC 2 cut(s) 36, 138
AcsI RAATTY 2 cut(s) 158, 175
AfaI GTAC 1 cut(s) 10
AlwI GGATC 2 cut(s) 36, 138
Ama87I CYCGRG 2 cut(s) 23, 45
ApoI RAATTY 2 cut(s) 158, 175
AvaI CYCGRG 2 cut(s) 23, 45
BglII AGATCT 1 cut(s) 206
BmeT110I CYCGRG 2 cut(s) 23, 45
BseMII CTCAG 1 cut(s) 26
BsiHKCI CYCGRG 2 cut(s) 23, 45
BsoBI CYCGRG 2 cut(s) 23, 45
Bsp143I GATC 4 cut(s) 41, 72, 130, 206
BspCNI CTCAG 1 cut(s) 25
BspPI GGATC 2 cut(s) 36, 138
BssMI GATC 4 cut(s) 41, 72, 130, 206
BstC8I GCNNGC 1 cut(s) 189
BstDEI CTNAG 2 cut(s) 12, 38
BstKTI GATC 4 cut(s) 44, 75, 133, 209
BstMBI GATC 4 cut(s) 41, 72, 130, 206
BstNSI RCATGY 1 cut(s) 191
BstX2I RGATCY 2 cut(s) 41, 206
BstYI RGATCY 2 cut(s) 41, 206
Cac8I GCNNGC 1 cut(s) 189
CseI GACGC 1 cut(s) 39
Csp6I GTAC 1 cut(s) 9
CviAII CATG 1 cut(s) 188
CviQI GTAC 1 cut(s) 9
DdeI CTNAG 2 cut(s) 12, 38
DpnI GATC 4 cut(s) 43, 74, 132, 208
DpnII GATC 4 cut(s) 41, 72, 130, 206
Eco88I CYCGRG 2 cut(s) 23, 45
FaeI CATG 1 cut(s) 191
FatI CATG 1 cut(s) 187
FauNDI CATATG 1 cut(s) 135
FblI GTMKAC 1 cut(s) 53
HgaI GACGC 1 cut(s) 39
Hin1II CATG 1 cut(s) 191
Hpy166II GTNNAC 1 cut(s) 54
Hpy188I TCNGA 1 cut(s) 15
Hpy188III TCNNGA 2 cut(s) 23, 45
Hpy8I GTNNAC 1 cut(s) 54
Hpy99I CGWCG 1 cut(s) 216
HpyCH4V TGCA 1 cut(s) 164
HpyF3I CTNAG 2 cut(s) 12, 38
Hsp92II CATG 1 cut(s) 191
Kzo9I GATC 4 cut(s) 41, 72, 130, 206
MalI GATC 4 cut(s) 43, 74, 132, 208
MboI GATC 4 cut(s) 41, 72, 130, 206
MflI RGATCY 2 cut(s) 41, 206
MluCI AATT 3 cut(s) 149, 158, 175
MnlI CCTC 2 cut(s) 44, 176
MseI TTAA 1 cut(s) 217
NdeI CATATG 1 cut(s) 135
NdeII GATC 4 cut(s) 41, 72, 130, 206
NlaIII CATG 1 cut(s) 191
NspI RCATGY 1 cut(s) 191
PaeI GCATGC 1 cut(s) 191
PaeR7I CTCGAG 1 cut(s) 23
PsuI RGATCY 2 cut(s) 41, 206
RsaI GTAC 1 cut(s) 10
RsaNI GTAC 1 cut(s) 9
SaqAI TTAA 1 cut(s) 217
Sau3AI GATC 4 cut(s) 41, 72, 130, 206
SetI ASST 2 cut(s) 10, 67
Sfr274I CTCGAG 1 cut(s) 23
SgeI CNNG 7 cut(s) 35, 37, 57, 59, 88, 194, 200
SlaI CTCGAG 1 cut(s) 23
SmlI CTYRAG 1 cut(s) 23
SmoI CTYRAG 1 cut(s) 23
SphI GCATGC 1 cut(s) 191
Sse9I AATT 3 cut(s) 149, 158, 175
TaqI TCGA 2 cut(s) 24, 181
TasI AATT 3 cut(s) 149, 158, 175
Tru1I TTAA 1 cut(s) 217
Tru9I TTAA 1 cut(s) 217
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 143
XapI RAATTY 2 cut(s) 158, 175
XceI RCATGY 1 cut(s) 191
XhoI CTCGAG 1 cut(s) 23
XmiI GTMKAC 1 cut(s) 53
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.