RchiOBHm_Chr2g0118451

function. Its presence in a non-photosynthetic plant (Epifagus virginiana) and experiments in tobacco indicate that it has an essential function which is probably not related to photosynthesis

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0004273
Physical Location & Seq
Reverse (-)
30720242 .. 30720868
627 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ49125

Sequence Viewer

Length: 627 bp
ATGGTTCCAAAGGATGAACTGGACAGTTCCAATGAGATTTCATTCTTGAACAAAAATCTATTTTGTGATTTATTTCATCTATTCCATGACTTGAACAGGGGGGGATACACGTTACACCACGATTTTGAATCAGAAGAGAGATTTCAAGAAATGGCAGATCTATTCACTCTATCAATAACCGAGCCGGATTCGTTATATCATAAGGGATTTTCCTTTTCTATTGATTCCTACAGATTGGATCAAAAACAATTCTTGAATGAGGTATTCAACTCCAGGGATGAATCGAAAAAGAAATCTTTATTGGTTCTACCTCCTATTTTTTATGAAGAGAATGAATCTTTTTATCGAAGGATCAGAAAAAAATGGGTCCGGACCTCCTACGGGAATGATTTGGAAGATCCAAAACCAAAAATAGTGGTATTTGCTAGCAACAACATAATGGAGGCAGTCAATCAATATAGATTGATCCGAAATCTGATTCAAATCCAATATAGCACCTATGGGTACATAAGAAATGTATTGAATCGATTCTTTTTAATGAATAGATCCGATTGCAACTTCAAATATGGAATTCAAAGGGATCAAATAGAAAATGATACTCTGAATCATAGAACTATAATGAAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AAA DUF825

Protein Analysis

208

Amino Acids

25.02

Weight (kDa)

6.32

Isoelectric Point (pI)

35.14

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ycf2 PF05695 1 - 208 8.1e-128 Ycf2 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 369
AclWI GGATC 6 cut(s) 246, 359, 392, 460, 540, 588
AcsI RAATTY 1 cut(s) 570
AfaI GTAC 1 cut(s) 506
AfiI CCNNNNNNNGG 1 cut(s) 381
AflIII ACRYGT 1 cut(s) 108
AjnI CCWGG 1 cut(s) 272
AjuI GAANNNNNNNTTGG 2 cut(s) 284, 316
AlwI GGATC 6 cut(s) 246, 359, 392, 460, 540, 588
Aor13HI TCCGGA 1 cut(s) 369
ApoI RAATTY 1 cut(s) 570
Asp700I GAANNNNTTC 1 cut(s) 527
AspS9I GGNCC 2 cut(s) 367, 372
AsuNHI GCTAGC 1 cut(s) 425
AvaII GGWCC 2 cut(s) 367, 372
BciT130I CCWGG 1 cut(s) 274
BciVI GTATCC 1 cut(s) 98
BfaI CTAG 1 cut(s) 426
BfmI CTRYAG 1 cut(s) 229
BfuI GTATCC 1 cut(s) 98
BglII AGATCT 1 cut(s) 157
Bme1390I CCNGG 1 cut(s) 274
Bme18I GGWCC 2 cut(s) 367, 372
BmgT120I GGNCC 2 cut(s) 367, 372
BmiI GGNNCC 2 cut(s) 6, 368
BmrFI CCNGG 1 cut(s) 274
BmtI GCTAGC 1 cut(s) 429
BpmI CTGGAG 1 cut(s) 256
Bsa29I ATCGAT 1 cut(s) 526
BsaBI GATNNNNATC 1 cut(s) 482
BsaJI CCNNGG 1 cut(s) 273
BsaWI WCCGGW 1 cut(s) 369
Bsc4I CCNNNNNNNGG 1 cut(s) 381
Bse1I ACTGG 1 cut(s) 24
Bse8I GATNNNNATC 1 cut(s) 482
BseAI TCCGGA 1 cut(s) 369
BseBI CCWGG 1 cut(s) 274
BseCI ATCGAT 1 cut(s) 526
BseDI CCNNGG 1 cut(s) 273
BseGI GGATG 2 cut(s) 19, 283
BseJI GATNNNNATC 1 cut(s) 482
BseLI CCNNNNNNNGG 1 cut(s) 381
BseNI ACTGG 1 cut(s) 24
BshVI ATCGAT 1 cut(s) 526
BsiSI CCGG 2 cut(s) 185, 370
BslI CCNNNNNNNGG 1 cut(s) 381
Bsp13I TCCGGA 1 cut(s) 369
Bsp143I GATC 7 cut(s) 157, 238, 351, 397, 465, 545, 580
BspDI ATCGAT 1 cut(s) 526
BspEI TCCGGA 1 cut(s) 369
BspLI GGNNCC 2 cut(s) 6, 368
BspOI GCTAGC 1 cut(s) 429
BspPI GGATC 6 cut(s) 246, 359, 392, 460, 540, 588
BsrI ACTGG 1 cut(s) 24
BssECI CCNNGG 1 cut(s) 273
BssMI GATC 7 cut(s) 157, 238, 351, 397, 465, 545, 580
Bst2UI CCWGG 1 cut(s) 274
Bst4CI ACNGT 1 cut(s) 26
Bst6I CTCTTC 2 cut(s) 129, 321
BstC8I GCNNGC 1 cut(s) 427
BstF5I GGATG 2 cut(s) 19, 283
BstKTI GATC 7 cut(s) 160, 241, 354, 400, 468, 548, 583
BstMBI GATC 7 cut(s) 157, 238, 351, 397, 465, 545, 580
BstNI CCWGG 1 cut(s) 274
BstSCI CCNGG 1 cut(s) 272
BstSFI CTRYAG 1 cut(s) 229
BstX2I RGATCY 3 cut(s) 157, 397, 545
BstYI RGATCY 3 cut(s) 157, 397, 545
Bsu15I ATCGAT 1 cut(s) 526
BsuI GTATCC 1 cut(s) 98
BsuTUI ATCGAT 1 cut(s) 526
BtsCI GGATG 2 cut(s) 19, 283
Cac8I GCNNGC 1 cut(s) 427
Cfr13I GGNCC 2 cut(s) 367, 372
ClaI ATCGAT 1 cut(s) 526
Csp6I GTAC 1 cut(s) 505
CspCI CAANNNNNGTGG 2 cut(s) 396, 431
CviAII CATG 1 cut(s) 86
CviJI RGCY 1 cut(s) 184
CviKI_1 RGCY 1 cut(s) 184
CviQI GTAC 1 cut(s) 505
DpnI GATC 7 cut(s) 159, 240, 353, 399, 467, 547, 582
DpnII GATC 7 cut(s) 157, 238, 351, 397, 465, 545, 580
Eam1104I CTCTTC 2 cut(s) 129, 321
EarI CTCTTC 2 cut(s) 129, 321
Eco47I GGWCC 2 cut(s) 367, 372
EcoRI GAATTC 1 cut(s) 570
EcoRII CCWGG 1 cut(s) 272
FaeI CATG 1 cut(s) 89
FatI CATG 1 cut(s) 85
FokI GGATG 2 cut(s) 26, 290
FspBI CTAG 1 cut(s) 426
GsuI CTGGAG 1 cut(s) 256
HapII CCGG 2 cut(s) 185, 370
Hin1II CATG 1 cut(s) 89
HinfI GANTC 9 cut(s) 128, 188, 224, 281, 335, 478, 523, 528, 604
HpaII CCGG 2 cut(s) 185, 370
Hpy188I TCNGA 6 cut(s) 133, 356, 470, 477, 550, 603
Hpy188III TCNNGA 4 cut(s) 46, 146, 253, 370
HpyAV CCTTC 1 cut(s) 342
HpyCH4III ACNGT 1 cut(s) 26
HpyCH4IV ACGT 1 cut(s) 110
HpyCH4V TGCA 1 cut(s) 555
HpySE526I ACGT 1 cut(s) 110
Hsp92II CATG 1 cut(s) 89
Kpn2I TCCGGA 1 cut(s) 369
Kzo9I GATC 7 cut(s) 157, 238, 351, 397, 465, 545, 580
LpnPI CCDG 6 cut(s) 5, 82, 198, 259, 286, 383
MaeI CTAG 1 cut(s) 426
MaeII ACGT 1 cut(s) 110
MaeIII GTNAC 1 cut(s) 111
MalI GATC 7 cut(s) 159, 240, 353, 399, 467, 547, 582
MboI GATC 7 cut(s) 157, 238, 351, 397, 465, 545, 580
MboII GAAGA 3 cut(s) 146, 338, 407
MflI RGATCY 3 cut(s) 157, 397, 545
MluCI AATT 2 cut(s) 248, 570
MnlI CCTC 4 cut(s) 253, 321, 385, 436
MroI TCCGGA 1 cut(s) 369
MroXI GAANNNNTTC 1 cut(s) 527
MseI TTAA 1 cut(s) 536
MspI CCGG 2 cut(s) 185, 370
MspR9I CCNGG 1 cut(s) 274
MvaI CCWGG 1 cut(s) 274
NdeII GATC 7 cut(s) 157, 238, 351, 397, 465, 545, 580
NheI GCTAGC 1 cut(s) 425
NlaIII CATG 1 cut(s) 89
NlaIV GGNNCC 2 cut(s) 6, 368
PdmI GAANNNNTTC 1 cut(s) 527
PfeI GAWTC 9 cut(s) 128, 188, 224, 281, 335, 478, 523, 528, 604
Psp6I CCWGG 1 cut(s) 272
PspGI CCWGG 1 cut(s) 272
PspN4I GGNNCC 2 cut(s) 6, 368
PspPI GGNCC 2 cut(s) 367, 372
PsuI RGATCY 3 cut(s) 157, 397, 545
RsaI GTAC 1 cut(s) 506
RsaNI GTAC 1 cut(s) 505
SaqAI TTAA 1 cut(s) 536
Sau3AI GATC 7 cut(s) 157, 238, 351, 397, 465, 545, 580
Sau96I GGNCC 2 cut(s) 367, 372
ScrFI CCNGG 1 cut(s) 274
SetI ASST 5 cut(s) 113, 264, 313, 377, 500
SfcI CTRYAG 1 cut(s) 229
SinI GGWCC 2 cut(s) 367, 372
Sse9I AATT 2 cut(s) 248, 570
SspMI CTAG 1 cut(s) 426
StyD4I CCNGG 1 cut(s) 272
TaaI ACNGT 1 cut(s) 26
TaiI ACGT 1 cut(s) 113
TaqI TCGA 3 cut(s) 284, 346, 526
TasI AATT 2 cut(s) 248, 570
TfiI GAWTC 9 cut(s) 128, 188, 224, 281, 335, 478, 523, 528, 604
Tru1I TTAA 1 cut(s) 536
Tru9I TTAA 1 cut(s) 536
TspDTI ATGAA 7 cut(s) 30, 30, 65, 294, 339, 348, 554
VpaK11BI GGWCC 2 cut(s) 367, 372
XapI RAATTY 1 cut(s) 570
XmnI GAANNNNTTC 1 cut(s) 527
XspI CTAG 1 cut(s) 426
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.