FvH4_6g37931

General transcription factor IIE subunit

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb6
Physical Location & Seq
Forward (+)
29965779 .. 29966895
1117 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_6g37931.t1

Sequence Viewer

Length: 255 bp
ATGGCATTTTCGCGCTGTCACAATCTGTGGTGGCTAAAACAATTATTTTTTGTAGTGAGTGCTTCACGACTAGCAGAGAATGGTGATTCTAGAGCGATAAATCCCTCCATTTCTTCTCATGGGCTAGGGGATGGGACGCCCATGCCTTTCGTTGGAGATACAAAGGAATTGAGTGAGGAAGAGAGGAAGTTGTGGAATGACCAGCTGAAGCATGGAGGCTTACAAGATGGAATTGGACAAATACAACAAGTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families

Protein Analysis

85

Amino Acids

9.38

Weight (kDa)

5.82

Isoelectric Point (pI)

56.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 13
AcuI CTGAAG 1 cut(s) 227
AcyI GRCGYC 1 cut(s) 137
AfiI CCNNNNNNNGG 1 cut(s) 152
AluBI AGCT 1 cut(s) 205
AluI AGCT 1 cut(s) 205
AspLEI GCGC 1 cut(s) 15
AsuHPI GGTGA 1 cut(s) 95
BccI CCATC 2 cut(s) 125, 221
BfaI CTAG 3 cut(s) 71, 90, 125
BsaHI GRCGYC 1 cut(s) 137
Bsc4I CCNNNNNNNGG 1 cut(s) 152
BseGI GGATG 1 cut(s) 136
BseLI CCNNNNNNNGG 1 cut(s) 152
Bsh1236I CGCG 1 cut(s) 13
BslFI GGGAC 1 cut(s) 148
BslI CCNNNNNNNGG 1 cut(s) 152
BsmFI GGGAC 1 cut(s) 148
BspFNI CGCG 1 cut(s) 13
BssNI GRCGYC 1 cut(s) 137
Bst6I CTCTTC 1 cut(s) 174
BstACI GRCGYC 1 cut(s) 137
BstF5I GGATG 1 cut(s) 136
BstFNI CGCG 1 cut(s) 13
BstHHI GCGC 1 cut(s) 15
BstUI CGCG 1 cut(s) 13
BtsCI GGATG 1 cut(s) 136
CfoI GCGC 1 cut(s) 15
CseI GACGC 1 cut(s) 145
CviAII CATG 3 cut(s) 119, 142, 212
CviJI RGCY 4 cut(s) 34, 124, 205, 219
CviKI_1 RGCY 4 cut(s) 34, 124, 205, 219
Eam1104I CTCTTC 1 cut(s) 174
EarI CTCTTC 1 cut(s) 174
Eco57I CTGAAG 1 cut(s) 227
FaeI CATG 3 cut(s) 122, 145, 215
FaiI YATR 3 cut(s) 120, 143, 213
FaqI GGGAC 1 cut(s) 148
FatI CATG 3 cut(s) 118, 141, 211
FokI GGATG 1 cut(s) 143
FspBI CTAG 3 cut(s) 71, 90, 125
GlaI GCGC 1 cut(s) 14
HgaI GACGC 1 cut(s) 145
HhaI GCGC 1 cut(s) 15
Hin1I GRCGYC 1 cut(s) 137
Hin1II CATG 3 cut(s) 122, 145, 215
Hin6I GCGC 1 cut(s) 13
HinP1I GCGC 1 cut(s) 13
HinfI GANTC 1 cut(s) 86
HphI GGTGA 1 cut(s) 95
Hpy188I TCNGA 1 cut(s) 254
Hpy188III TCNNGA 2 cut(s) 66, 90
Hsp92I GRCGYC 1 cut(s) 137
Hsp92II CATG 3 cut(s) 122, 145, 215
HspAI GCGC 1 cut(s) 13
LpnPI CCDG 1 cut(s) 215
MaeI CTAG 3 cut(s) 71, 90, 125
MaeIII GTNAC 1 cut(s) 17
MboII GAAGA 2 cut(s) 105, 191
MluCI AATT 3 cut(s) 41, 167, 231
MmeI TCCRAC 1 cut(s) 133
MnlI CCTC 4 cut(s) 115, 169, 177, 209
MspA1I CMGCKG 1 cut(s) 205
MvnI CGCG 1 cut(s) 13
NlaIII CATG 3 cut(s) 122, 145, 215
NmuCI GTSAC 1 cut(s) 17
PfeI GAWTC 1 cut(s) 86
PvuII CAGCTG 1 cut(s) 205
SetI ASST 1 cut(s) 207
Sse9I AATT 3 cut(s) 41, 167, 231
SspMI CTAG 3 cut(s) 71, 90, 125
TasI AATT 3 cut(s) 41, 167, 231
TfiI GAWTC 1 cut(s) 86
TseFI GTSAC 1 cut(s) 17
Tsp45I GTSAC 1 cut(s) 17
XbaI TCTAGA 1 cut(s) 89
XcmI CCANNNNNNNNNTGG 1 cut(s) 209
XspI CTAG 3 cut(s) 71, 90, 125
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.