FvH4_7g17070

Belongs to the yippee family

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb7
Physical Location & Seq
Forward (+)
14601965 .. 14603518
1554 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_7g17070.t2

Sequence Viewer

Length: 324 bp
ATGGCTGATTTGGCTTGGCGAAGGTTATACTGCTGCTACAAGTGCCAGAACCATATATGCTGTCATGATGATATTCTCAATAAATATTATCAGACTAGAAGTGGCAGAAGAGCCTTTCTGTTCGCTCATGCTATAAATGTGTTTCAAGGGCCTAAAGAGGACCGGCAACTCATCACTGGCCGTTACACAGTTGCTGATGTATACTGCAGCGATTGCAGCGTGGTGTTGGGCTGCAAATATGTAAAAGCTTATGATGAGTTGCACAAGTACAAAGAAGGGAAATATTGCATTGCAATGTTCAACATTGTCAAGGCAAACTGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

108

Amino Acids

12.62

Weight (kDa)

8.85

Isoelectric Point (pI)

40.44

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Yippee-Mis18 PF03226 37 - 79 3.5e-06 Yippee zinc-binding/DNA-binding /Mis18, centromere assembly
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 201
AcoI YGGCCR 1 cut(s) 178
AfaI GTAC 1 cut(s) 269
AgsI TTSAA 2 cut(s) 146, 301
AluBI AGCT 1 cut(s) 248
AluI AGCT 1 cut(s) 248
AlwNI CAGNNNCTG 1 cut(s) 194
AoxI GGCC 2 cut(s) 149, 178
ApeKI GCWGC 4 cut(s) 33, 207, 216, 231
AspS9I GGNCC 2 cut(s) 149, 160
AvaII GGWCC 1 cut(s) 160
BbvI GCAGC 4 cut(s) 20, 218, 219, 228
BceAI ACGGC 1 cut(s) 165
BfaI CTAG 1 cut(s) 96
BfmI CTRYAG 1 cut(s) 205
BisI GCNGC 4 cut(s) 34, 208, 217, 232
BlsI GCNGC 4 cut(s) 35, 209, 218, 233
Bme18I GGWCC 1 cut(s) 160
BmgT120I GGNCC 2 cut(s) 149, 160
Bse118I RCCGGY 1 cut(s) 162
Bse1I ACTGG 2 cut(s) 181, 323
Bse3DI GCAATG 2 cut(s) 288, 300
BseMI GCAATG 2 cut(s) 288, 300
BseNI ACTGG 2 cut(s) 181, 323
BseXI GCAGC 4 cut(s) 20, 218, 219, 228
BshFI GGCC 2 cut(s) 151, 180
BsiSI CCGG 1 cut(s) 163
BsnI GGCC 2 cut(s) 151, 180
BspANI GGCC 2 cut(s) 151, 180
BspHI TCATGA 1 cut(s) 64
BspMAI CTGCAG 1 cut(s) 209
BspQI GCTCTTC 1 cut(s) 103
BsrDI GCAATG 2 cut(s) 288, 300
BsrFI RCCGGY 1 cut(s) 162
BsrI ACTGG 2 cut(s) 181, 323
BssAI RCCGGY 1 cut(s) 162
BssNAI GTATAC 1 cut(s) 202
Bst1107I GTATAC 1 cut(s) 202
Bst4CI ACNGT 1 cut(s) 190
Bst6I CTCTTC 1 cut(s) 103
BstAPI GCANNNNNTGC 1 cut(s) 213
BstMWI GCNNNNNNNGC 4 cut(s) 11, 42, 213, 216
BstSFI CTRYAG 1 cut(s) 205
BstV1I GCAGC 4 cut(s) 20, 218, 219, 228
BstZ17I GTATAC 1 cut(s) 202
BsuRI GGCC 2 cut(s) 151, 180
BtsIMutI CAGTG 1 cut(s) 174
CaiI CAGNNNCTG 1 cut(s) 194
CciI TCATGA 1 cut(s) 64
Cfr10I RCCGGY 1 cut(s) 162
Cfr13I GGNCC 2 cut(s) 149, 160
Csp6I GTAC 1 cut(s) 268
CviAII CATG 2 cut(s) 65, 128
CviJI RGCY 7 cut(s) 5, 14, 113, 151, 180, 231, 248
CviKI_1 RGCY 7 cut(s) 5, 14, 113, 151, 180, 231, 248
CviQI GTAC 1 cut(s) 268
EaeI YGGCCR 1 cut(s) 178
Eam1104I CTCTTC 1 cut(s) 103
EarI CTCTTC 1 cut(s) 103
Eco47I GGWCC 1 cut(s) 160
EcoO109I RGGNCCY 1 cut(s) 149
FaeI CATG 2 cut(s) 68, 131
FatI CATG 2 cut(s) 64, 127
FblI GTMKAC 1 cut(s) 201
Fnu4HI GCNGC 4 cut(s) 34, 208, 217, 232
Fsp4HI GCNGC 4 cut(s) 34, 208, 217, 232
FspBI CTAG 1 cut(s) 96
GluI GCNGC 4 cut(s) 34, 208, 217, 232
HaeIII GGCC 2 cut(s) 151, 180
HapII CCGG 1 cut(s) 163
Hin1II CATG 2 cut(s) 68, 131
HindIII AAGCTT 1 cut(s) 246
HpaII CCGG 1 cut(s) 163
Hpy166II GTNNAC 1 cut(s) 202
Hpy188I TCNGA 1 cut(s) 93
Hpy188III TCNNGA 1 cut(s) 65
Hpy8I GTNNAC 1 cut(s) 202
HpyAV CCTTC 2 cut(s) 15, 269
HpyCH4III ACNGT 1 cut(s) 190
HpyCH4V TGCA 6 cut(s) 207, 216, 234, 262, 288, 293
HpyF10VI GCNNNNNNNGC 4 cut(s) 11, 42, 213, 216
Hsp92II CATG 2 cut(s) 68, 131
LguI GCTCTTC 1 cut(s) 103
LpnPI CCDG 4 cut(s) 59, 162, 176, 304
Lsp1109I GCAGC 4 cut(s) 20, 218, 219, 228
MaeI CTAG 1 cut(s) 96
MaeIII GTNAC 1 cut(s) 182
MboII GAAGA 1 cut(s) 120
MnlI CCTC 1 cut(s) 151
MslI CAYNNNNRTG 1 cut(s) 293
MspI CCGG 1 cut(s) 163
MwoI GCNNNNNNNGC 4 cut(s) 11, 42, 213, 216
NlaIII CATG 2 cut(s) 68, 131
PagI TCATGA 1 cut(s) 64
PciSI GCTCTTC 1 cut(s) 103
PkrI GCNGC 4 cut(s) 35, 209, 218, 233
PspPI GGNCC 2 cut(s) 149, 160
PstI CTGCAG 1 cut(s) 209
PstNI CAGNNNCTG 1 cut(s) 194
RsaI GTAC 1 cut(s) 269
RsaNI GTAC 1 cut(s) 268
RseI CAYNNNNRTG 1 cut(s) 293
SapI GCTCTTC 1 cut(s) 103
SatI GCNGC 4 cut(s) 34, 208, 217, 232
Sau96I GGNCC 2 cut(s) 149, 160
SetI ASST 2 cut(s) 26, 250
SfcI CTRYAG 1 cut(s) 205
SinI GGWCC 1 cut(s) 160
SmiMI CAYNNNNRTG 1 cut(s) 293
SspI AATATT 2 cut(s) 86, 284
SspMI CTAG 1 cut(s) 96
TaaI ACNGT 1 cut(s) 190
TatI WGTACW 1 cut(s) 267
TscAI CASTG 1 cut(s) 181
TseI GCWGC 4 cut(s) 33, 207, 216, 231
TspRI CASTG 1 cut(s) 181
VpaK11BI GGWCC 1 cut(s) 160
XmiI GTMKAC 1 cut(s) 201
XspI CTAG 1 cut(s) 96
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.