MD01G1224700.v1.1

Belongs to the yippee family

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr01
Physical Location & Seq
Reverse (-)
31575372 .. 31577487
2116 bp
Loading structure...
UTR
Exon/CDS
Intron
MD01G1224700.v1.1.491

Sequence Viewer

Length: 321 bp
ATGGCGAATTTGGTAGGGCCTAGATTGTACAGCTGTTGTAATTGCAGAAACCATGTTTCCCTTCACGATGATATAATTTCCAAGGCTTTTCAGGGAAGACATGGCCGAGCTTTTCTGTTCTCCCATGCGATGAATGTCGTTGTTGGGGCAAAAGAAGACAGGCATCTCTTAACTGGTCTGCATACTGTTGCTGATATCCACTGTGGTGATTGCCGTGAGGTGTTGGGATGGAAGTATGAACGAGCTTATGAGGCATCGCAAAAGTACAAAGAAGGGAAGTTCATATTTGAGAAGTCAAAAATTGTGAAGGAAGATTGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

107

Amino Acids

12.18

Weight (kDa)

8.63

Isoelectric Point (pI)

15.24

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Yippee-Mis18 PF03226 10 - 102 8.2e-13 Yippee zinc-binding/DNA-binding /Mis18, centromere assembly
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 103
AcsI RAATTY 1 cut(s) 7
AfaI GTAC 2 cut(s) 29, 266
AleI CACNNNNGTG 1 cut(s) 204
AluBI AGCT 3 cut(s) 33, 110, 245
AluI AGCT 3 cut(s) 33, 110, 245
AoxI GGCC 2 cut(s) 17, 103
ApoI RAATTY 1 cut(s) 7
AspS9I GGNCC 1 cut(s) 17
AsuHPI GGTGA 1 cut(s) 218
BbsI GAAGAC 2 cut(s) 103, 162
BccI CCATC 1 cut(s) 222
BceAI ACGGC 1 cut(s) 198
BfaI CTAG 1 cut(s) 21
BmgT120I GGNCC 1 cut(s) 17
BmsI GCATC 2 cut(s) 172, 263
BpiI GAAGAC 2 cut(s) 103, 162
BsaJI CCNNGG 1 cut(s) 81
Bse1I ACTGG 1 cut(s) 178
BseDI CCNNGG 1 cut(s) 81
BseGI GGATG 1 cut(s) 233
BseNI ACTGG 1 cut(s) 178
BshFI GGCC 2 cut(s) 19, 105
BsnI GGCC 2 cut(s) 19, 105
Bsp1407I TGTACA 1 cut(s) 27
BspANI GGCC 2 cut(s) 19, 105
BsrGI TGTACA 1 cut(s) 27
BsrI ACTGG 1 cut(s) 178
BssECI CCNNGG 1 cut(s) 81
BssT1I CCWWGG 1 cut(s) 81
Bst4CI ACNGT 2 cut(s) 187, 203
BstAUI TGTACA 1 cut(s) 27
BstF5I GGATG 1 cut(s) 233
BstMWI GCNNNNNNNGC 1 cut(s) 251
BstV2I GAAGAC 2 cut(s) 103, 162
BsuRI GGCC 2 cut(s) 19, 105
BtgZI GCGATG 2 cut(s) 143, 240
BtsCI GGATG 1 cut(s) 233
BtsIMutI CAGTG 1 cut(s) 199
Cfr13I GGNCC 1 cut(s) 17
Csp6I GTAC 2 cut(s) 28, 265
CviAII CATG 3 cut(s) 53, 101, 125
CviJI RGCY 6 cut(s) 19, 33, 86, 105, 110, 245
CviKI_1 RGCY 6 cut(s) 19, 33, 86, 105, 110, 245
CviQI GTAC 2 cut(s) 28, 265
EaeI YGGCCR 1 cut(s) 103
Eco130I CCWWGG 1 cut(s) 81
Eco32I GATATC 1 cut(s) 196
EcoO109I RGGNCCY 1 cut(s) 17
EcoRV GATATC 1 cut(s) 196
EcoT14I CCWWGG 1 cut(s) 81
ErhI CCWWGG 1 cut(s) 81
FaeI CATG 3 cut(s) 56, 104, 128
FaiI YATR 8 cut(s) 54, 74, 102, 126, 183, 237, 249, 284
FatI CATG 3 cut(s) 52, 100, 124
FokI GGATG 1 cut(s) 240
FspBI CTAG 1 cut(s) 21
HaeIII GGCC 2 cut(s) 19, 105
Hin1II CATG 3 cut(s) 56, 104, 128
HphI GGTGA 1 cut(s) 218
Hpy188III TCNNGA 1 cut(s) 65
HpyAV CCTTC 3 cut(s) 71, 266, 301
HpyCH4III ACNGT 2 cut(s) 187, 203
HpyCH4V TGCA 2 cut(s) 45, 181
HpyF10VI GCNNNNNNNGC 1 cut(s) 251
Hsp92II CATG 3 cut(s) 56, 104, 128
LpnPI CCDG 3 cut(s) 77, 145, 159
LweI GCATC 2 cut(s) 172, 263
MaeI CTAG 1 cut(s) 21
MboII GAAGA 2 cut(s) 108, 167
MluCI AATT 4 cut(s) 7, 40, 75, 300
MnlI CCTC 2 cut(s) 211, 244
MseI TTAA 1 cut(s) 170
MslI CAYNNNNRTG 1 cut(s) 204
MspA1I CMGCKG 1 cut(s) 33
MwoI GCNNNNNNNGC 1 cut(s) 251
NlaIII CATG 3 cut(s) 56, 104, 128
NmeAIII GCCGAG 1 cut(s) 131
OliI CACNNNNGTG 1 cut(s) 204
PspPI GGNCC 1 cut(s) 17
PvuII CAGCTG 1 cut(s) 33
RsaI GTAC 2 cut(s) 29, 266
RsaNI GTAC 2 cut(s) 28, 265
RseI CAYNNNNRTG 1 cut(s) 204
SaqAI TTAA 1 cut(s) 170
Sau96I GGNCC 1 cut(s) 17
SetI ASST 4 cut(s) 35, 112, 222, 247
SfaNI GCATC 2 cut(s) 172, 263
SmiMI CAYNNNNRTG 1 cut(s) 204
Sse9I AATT 4 cut(s) 7, 40, 75, 300
SspMI CTAG 1 cut(s) 21
StyI CCWWGG 1 cut(s) 81
TaaI ACNGT 2 cut(s) 187, 203
TasI AATT 4 cut(s) 7, 40, 75, 300
TatI WGTACW 2 cut(s) 27, 264
Tru1I TTAA 1 cut(s) 170
Tru9I TTAA 1 cut(s) 170
TscAI CASTG 1 cut(s) 206
TspDTI ATGAA 3 cut(s) 146, 252, 271
TspRI CASTG 1 cut(s) 206
XapI RAATTY 1 cut(s) 7
XspI CTAG 1 cut(s) 21
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.