MD06G1115600.v1.1

Belongs to the yippee family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr06
OG0000903
Physical Location & Seq
Reverse (-)
25458358 .. 25458760
403 bp
Loading structure...
UTR
Exon/CDS
Intron
MD06G1115600.v1.1.491

Sequence Viewer

Length: 192 bp
ATGAACATTACAGTCGGGCCAAAAGAAGACAGACAACTCATGACTGGTCTGCACACGGTCGCTGATGTCTCCTGCTGCGACTGCCATGAGGTGCTGGGTTGGAAGTATGAACGCGCCTATGAGCAAACACAGAAGTACAAGGAAGGGAAATTCATTCTCGAGAAATCGAAGATAGTCAAGGAAAACTGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Yippee-Mis18

Protein Analysis

64

Amino Acids

7.41

Weight (kDa)

6.71

Isoelectric Point (pI)

27.78

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Yippee-Mis18 PF03226 18 - 59 1.5e-09 Yippee zinc-binding/DNA-binding /Mis18, centromere assembly
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 114
AcsI RAATTY 1 cut(s) 149
AfaI GTAC 1 cut(s) 137
Alw26I GTCTC 1 cut(s) 73
Ama87I CYCGRG 1 cut(s) 158
AoxI GGCC 1 cut(s) 17
ApeKI GCWGC 1 cut(s) 75
ApoI RAATTY 1 cut(s) 149
AspLEI GCGC 1 cut(s) 116
AspS9I GGNCC 1 cut(s) 17
AvaI CYCGRG 1 cut(s) 158
BbsI GAAGAC 1 cut(s) 33
BbvI GCAGC 1 cut(s) 62
BcoDI GTCTC 1 cut(s) 73
BisI GCNGC 1 cut(s) 76
BlsI GCNGC 1 cut(s) 77
BmeT110I CYCGRG 1 cut(s) 158
BmgT120I GGNCC 1 cut(s) 17
BpiI GAAGAC 1 cut(s) 33
Bse1I ACTGG 2 cut(s) 49, 191
BseNI ACTGG 2 cut(s) 49, 191
BseXI GCAGC 1 cut(s) 62
BseYI CCCAGC 1 cut(s) 94
BsgI GTGCAG 1 cut(s) 35
Bsh1236I CGCG 1 cut(s) 114
Bsh1285I CGRYCG 1 cut(s) 60
BshFI GGCC 1 cut(s) 19
BsiEI CGRYCG 1 cut(s) 60
BsiHKCI CYCGRG 1 cut(s) 158
BsmAI GTCTC 1 cut(s) 73
BsnI GGCC 1 cut(s) 19
BsoBI CYCGRG 1 cut(s) 158
BspANI GGCC 1 cut(s) 19
BspFNI CGCG 1 cut(s) 114
BspHI TCATGA 1 cut(s) 39
BsrI ACTGG 2 cut(s) 49, 191
Bst4CI ACNGT 2 cut(s) 13, 58
BstFNI CGCG 1 cut(s) 114
BstHHI GCGC 1 cut(s) 116
BstMAI GTCTC 1 cut(s) 73
BstMCI CGRYCG 1 cut(s) 60
BstMWI GCNNNNNNNGC 1 cut(s) 81
BstUI CGCG 1 cut(s) 114
BstV1I GCAGC 1 cut(s) 62
BstV2I GAAGAC 1 cut(s) 33
BsuRI GGCC 1 cut(s) 19
CciI TCATGA 1 cut(s) 39
CfoI GCGC 1 cut(s) 116
Cfr13I GGNCC 1 cut(s) 17
Csp6I GTAC 1 cut(s) 136
CviAII CATG 2 cut(s) 40, 86
CviJI RGCY 1 cut(s) 19
CviKI_1 RGCY 1 cut(s) 19
CviQI GTAC 1 cut(s) 136
Eco88I CYCGRG 1 cut(s) 158
FaeI CATG 2 cut(s) 43, 89
FaiI YATR 4 cut(s) 41, 87, 108, 120
FatI CATG 2 cut(s) 39, 85
Fnu4HI GCNGC 1 cut(s) 76
Fsp4HI GCNGC 1 cut(s) 76
GlaI GCGC 1 cut(s) 115
GluI GCNGC 1 cut(s) 76
GsaI CCCAGC 1 cut(s) 98
HaeIII GGCC 1 cut(s) 19
HhaI GCGC 1 cut(s) 116
Hin1II CATG 2 cut(s) 43, 89
Hin6I GCGC 1 cut(s) 114
HinP1I GCGC 1 cut(s) 114
Hpy188III TCNNGA 3 cut(s) 40, 158, 160
HpyAV CCTTC 1 cut(s) 137
HpyCH4III ACNGT 2 cut(s) 13, 58
HpyCH4V TGCA 1 cut(s) 52
HpyF10VI GCNNNNNNNGC 1 cut(s) 81
Hsp92II CATG 2 cut(s) 43, 89
HspAI GCGC 1 cut(s) 114
LpnPI CCDG 4 cut(s) 30, 80, 85, 172
Lsp1109I GCAGC 1 cut(s) 62
MboII GAAGA 2 cut(s) 38, 181
MluCI AATT 1 cut(s) 149
MmeI TCCRAC 1 cut(s) 80
MnlI CCTC 1 cut(s) 82
MvnI CGCG 1 cut(s) 114
MwoI GCNNNNNNNGC 1 cut(s) 81
NlaIII CATG 2 cut(s) 43, 89
PaeR7I CTCGAG 1 cut(s) 158
PagI TCATGA 1 cut(s) 39
PkrI GCNGC 1 cut(s) 77
PspFI CCCAGC 1 cut(s) 94
PspPI GGNCC 1 cut(s) 17
RsaI GTAC 1 cut(s) 137
RsaNI GTAC 1 cut(s) 136
SatI GCNGC 1 cut(s) 76
Sau96I GGNCC 1 cut(s) 17
SetI ASST 1 cut(s) 93
Sfr274I CTCGAG 1 cut(s) 158
SlaI CTCGAG 1 cut(s) 158
SmlI CTYRAG 1 cut(s) 158
SmoI CTYRAG 1 cut(s) 158
Sse9I AATT 1 cut(s) 149
TaaI ACNGT 2 cut(s) 13, 58
TaqI TCGA 2 cut(s) 159, 167
TasI AATT 1 cut(s) 149
TatI WGTACW 1 cut(s) 135
TseI GCWGC 1 cut(s) 75
TspDTI ATGAA 3 cut(s) 17, 123, 142
XapI RAATTY 1 cut(s) 149
XhoI CTCGAG 1 cut(s) 158
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.