Rmu_sc0008418.1_g000002

Belongs to the yippee family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0008418.1
Physical Location & Seq
Forward (+)
4693 .. 6246
1554 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0008418.1_g000002.1.cds

Sequence Viewer

Length: 351 bp
atgaatctcaagactccacagttcacaggtttctgggtcatcattgatcttgttctagtgagctgctgtaattgccgaaaccatgtttcacttcatgatgatatagtttccaaagcctttcagggaaaacacggtcgagcttttctgttctcccatgcgatgaatatagttgttggggcaaaggaagacaggcatctgatgacgggtctgcatactgtggctgacatctcttgcggcgattgccatgaggtgttggggtggaagtatgaaagagcttatgaggcttcacagaagtacaaggaagggaagttcatatttgagaagtcgaaaattgttaaggagggttggtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

116

Amino Acids

13.25

Weight (kDa)

8.29

Isoelectric Point (pI)

17.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 234
AfaI GTAC 1 cut(s) 296
AloI GAACNNNNNNTCC 2 cut(s) 293, 325
AluBI AGCT 3 cut(s) 63, 140, 275
AluI AGCT 3 cut(s) 63, 140, 275
ApeKI GCWGC 1 cut(s) 63
BbsI GAAGAC 1 cut(s) 192
BbvI GCAGC 1 cut(s) 50
BfaI CTAG 1 cut(s) 56
BisI GCNGC 2 cut(s) 64, 235
BlsI GCNGC 2 cut(s) 65, 236
BmsI GCATC 1 cut(s) 202
BpiI GAAGAC 1 cut(s) 192
BsaXI ACNNNNNCTCC 1 cut(s) 332
BseXI GCAGC 1 cut(s) 50
Bsh1285I CGRYCG 1 cut(s) 136
BsiEI CGRYCG 1 cut(s) 136
Bsp143I GATC 1 cut(s) 46
BspACI CCGC 1 cut(s) 234
BspHI TCATGA 1 cut(s) 94
BssMI GATC 1 cut(s) 46
Bst4CI ACNGT 3 cut(s) 21, 134, 217
BstKTI GATC 1 cut(s) 49
BstMBI GATC 1 cut(s) 46
BstMCI CGRYCG 1 cut(s) 136
BstMWI GCNNNNNNNGC 3 cut(s) 72, 240, 281
BstV1I GCAGC 1 cut(s) 50
BstV2I GAAGAC 1 cut(s) 192
BtgZI GCGATG 1 cut(s) 173
CciI TCATGA 1 cut(s) 94
Csp6I GTAC 1 cut(s) 295
CviAII CATG 4 cut(s) 83, 95, 155, 245
CviJI RGCY 6 cut(s) 63, 116, 140, 221, 275, 284
CviKI_1 RGCY 6 cut(s) 63, 116, 140, 221, 275, 284
CviQI GTAC 1 cut(s) 295
DpnI GATC 1 cut(s) 48
DpnII GATC 1 cut(s) 46
FaeI CATG 4 cut(s) 86, 98, 158, 248
FatI CATG 4 cut(s) 82, 94, 154, 244
Fnu4HI GCNGC 2 cut(s) 64, 235
Fsp4HI GCNGC 2 cut(s) 64, 235
FspBI CTAG 1 cut(s) 56
GluI GCNGC 2 cut(s) 64, 235
Hin1II CATG 4 cut(s) 86, 98, 158, 248
HinfI GANTC 2 cut(s) 4, 13
Hpy166II GTNNAC 1 cut(s) 24
Hpy188I TCNGA 1 cut(s) 198
Hpy188III TCNNGA 2 cut(s) 10, 95
Hpy8I GTNNAC 1 cut(s) 24
HpyAV CCTTC 1 cut(s) 296
HpyCH4III ACNGT 3 cut(s) 21, 134, 217
HpyCH4V TGCA 1 cut(s) 211
HpyF10VI GCNNNNNNNGC 3 cut(s) 72, 240, 281
Hsp92II CATG 4 cut(s) 86, 98, 158, 248
Kzo9I GATC 1 cut(s) 46
LpnPI CCDG 4 cut(s) 12, 19, 107, 175
Lsp1109I GCAGC 1 cut(s) 50
LweI GCATC 1 cut(s) 202
MaeI CTAG 1 cut(s) 56
MalI GATC 1 cut(s) 48
MboI GATC 1 cut(s) 46
MboII GAAGA 1 cut(s) 197
MluCI AATT 2 cut(s) 70, 330
MlyI GAGTC 1 cut(s) 7
MnlI CCTC 3 cut(s) 241, 274, 334
MseI TTAA 1 cut(s) 336
MwoI GCNNNNNNNGC 3 cut(s) 72, 240, 281
NdeII GATC 1 cut(s) 46
NlaIII CATG 4 cut(s) 86, 98, 158, 248
PagI TCATGA 1 cut(s) 94
PfeI GAWTC 1 cut(s) 4
PkrI GCNGC 2 cut(s) 65, 236
PleI GAGTC 1 cut(s) 7
PpsI GAGTC 1 cut(s) 7
RsaI GTAC 1 cut(s) 296
RsaNI GTAC 1 cut(s) 295
SaqAI TTAA 1 cut(s) 336
SatI GCNGC 2 cut(s) 64, 235
Sau3AI GATC 1 cut(s) 46
SchI GAGTC 1 cut(s) 7
SetI ASST 5 cut(s) 31, 65, 142, 252, 277
SfaNI GCATC 1 cut(s) 202
SmlI CTYRAG 1 cut(s) 8
SmoI CTYRAG 1 cut(s) 8
Sse9I AATT 2 cut(s) 70, 330
SsiI CCGC 1 cut(s) 234
SspMI CTAG 1 cut(s) 56
TaaI ACNGT 3 cut(s) 21, 134, 217
TaqI TCGA 2 cut(s) 136, 326
TasI AATT 2 cut(s) 70, 330
TatI WGTACW 1 cut(s) 294
TauI GCSGC 1 cut(s) 237
TfiI GAWTC 1 cut(s) 4
Tru1I TTAA 1 cut(s) 336
Tru9I TTAA 1 cut(s) 336
TseI GCWGC 1 cut(s) 63
TspDTI ATGAA 5 cut(s) 17, 83, 176, 282, 301
XspI CTAG 1 cut(s) 56
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.