MD06G1115900.v1.1

Belongs to the yippee family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr06
OG0000903
Physical Location & Seq
Reverse (-)
25482478 .. 25482669
192 bp
Loading structure...
UTR
Exon/CDS
Intron
MD06G1115900.v1.1.491

Sequence Viewer

Length: 192 bp
ATGAACATTACAGTCGGGCCAAAAGAAGACAGACAACTCATGACTGGTCTTCACACGGTCGCTGATGTCTCCTGCTGCGACTGCCATGAGGTGCTGGGTTGGAAGTATGAAGGGGCCTATGAGCAAACACAGAAGTACAAGGAAGGGAAATTCATTCTCGAGAAATCGAAGATAGTCAAGGAAGACTGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Yippee-Mis18

Protein Analysis

64

Amino Acids

7.31

Weight (kDa)

5.58

Isoelectric Point (pI)

31.13

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Yippee-Mis18 PF03226 18 - 59 4.8e-09 Yippee zinc-binding/DNA-binding /Mis18, centromere assembly
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 149
AfaI GTAC 1 cut(s) 137
Alw26I GTCTC 1 cut(s) 73
Ama87I CYCGRG 1 cut(s) 158
AoxI GGCC 2 cut(s) 17, 114
ApeKI GCWGC 1 cut(s) 75
ApoI RAATTY 1 cut(s) 149
AspS9I GGNCC 2 cut(s) 17, 114
AvaI CYCGRG 1 cut(s) 158
BbsI GAAGAC 2 cut(s) 33, 41
BbvI GCAGC 1 cut(s) 62
BcoDI GTCTC 1 cut(s) 73
BisI GCNGC 1 cut(s) 76
BlsI GCNGC 1 cut(s) 77
BmeT110I CYCGRG 1 cut(s) 158
BmgT120I GGNCC 2 cut(s) 17, 114
BmiI GGNNCC 1 cut(s) 115
BpiI GAAGAC 2 cut(s) 33, 41
Bse1I ACTGG 2 cut(s) 49, 191
BseNI ACTGG 2 cut(s) 49, 191
BseXI GCAGC 1 cut(s) 62
BseYI CCCAGC 1 cut(s) 94
Bsh1285I CGRYCG 1 cut(s) 60
BshFI GGCC 2 cut(s) 19, 116
BsiEI CGRYCG 1 cut(s) 60
BsiHKCI CYCGRG 1 cut(s) 158
BsmAI GTCTC 1 cut(s) 73
BsnI GGCC 2 cut(s) 19, 116
BsoBI CYCGRG 1 cut(s) 158
BspANI GGCC 2 cut(s) 19, 116
BspHI TCATGA 1 cut(s) 39
BspLI GGNNCC 1 cut(s) 115
BsrI ACTGG 2 cut(s) 49, 191
Bst4CI ACNGT 2 cut(s) 13, 58
BstMAI GTCTC 1 cut(s) 73
BstMCI CGRYCG 1 cut(s) 60
BstMWI GCNNNNNNNGC 1 cut(s) 81
BstV1I GCAGC 1 cut(s) 62
BstV2I GAAGAC 2 cut(s) 33, 41
BsuRI GGCC 2 cut(s) 19, 116
CciI TCATGA 1 cut(s) 39
Cfr13I GGNCC 2 cut(s) 17, 114
Csp6I GTAC 1 cut(s) 136
CviAII CATG 2 cut(s) 40, 86
CviJI RGCY 2 cut(s) 19, 116
CviKI_1 RGCY 2 cut(s) 19, 116
CviQI GTAC 1 cut(s) 136
Eco88I CYCGRG 1 cut(s) 158
EcoO109I RGGNCCY 1 cut(s) 114
FaeI CATG 2 cut(s) 43, 89
FaiI YATR 4 cut(s) 41, 87, 108, 120
FatI CATG 2 cut(s) 39, 85
Fnu4HI GCNGC 1 cut(s) 76
Fsp4HI GCNGC 1 cut(s) 76
GluI GCNGC 1 cut(s) 76
GsaI CCCAGC 1 cut(s) 98
HaeIII GGCC 2 cut(s) 19, 116
Hin1II CATG 2 cut(s) 43, 89
Hpy188III TCNNGA 3 cut(s) 40, 158, 160
HpyAV CCTTC 2 cut(s) 104, 137
HpyCH4III ACNGT 2 cut(s) 13, 58
HpyF10VI GCNNNNNNNGC 1 cut(s) 81
Hsp92II CATG 2 cut(s) 43, 89
LpnPI CCDG 4 cut(s) 30, 80, 85, 172
Lsp1109I GCAGC 1 cut(s) 62
MboII GAAGA 3 cut(s) 38, 41, 181
MluCI AATT 1 cut(s) 149
MmeI TCCRAC 1 cut(s) 80
MnlI CCTC 1 cut(s) 82
MwoI GCNNNNNNNGC 1 cut(s) 81
NlaIII CATG 2 cut(s) 43, 89
NlaIV GGNNCC 1 cut(s) 115
PaeR7I CTCGAG 1 cut(s) 158
PagI TCATGA 1 cut(s) 39
PkrI GCNGC 1 cut(s) 77
PspFI CCCAGC 1 cut(s) 94
PspN4I GGNNCC 1 cut(s) 115
PspPI GGNCC 2 cut(s) 17, 114
RsaI GTAC 1 cut(s) 137
RsaNI GTAC 1 cut(s) 136
SatI GCNGC 1 cut(s) 76
Sau96I GGNCC 2 cut(s) 17, 114
SetI ASST 1 cut(s) 93
Sfr274I CTCGAG 1 cut(s) 158
SlaI CTCGAG 1 cut(s) 158
SmlI CTYRAG 1 cut(s) 158
SmoI CTYRAG 1 cut(s) 158
Sse9I AATT 1 cut(s) 149
TaaI ACNGT 2 cut(s) 13, 58
TaqI TCGA 2 cut(s) 159, 167
TasI AATT 1 cut(s) 149
TatI WGTACW 1 cut(s) 135
TseI GCWGC 1 cut(s) 75
TspDTI ATGAA 3 cut(s) 17, 123, 142
XapI RAATTY 1 cut(s) 149
XhoI CTCGAG 1 cut(s) 158
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.