Prupe.2G314900_v2.0.a1

Belongs to the yippee family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp02
OG0000903
Physical Location & Seq
Reverse (-)
29601364 .. 29603497
2134 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.2G314900.1

Sequence Viewer

Length: 321 bp
ATGGCGGATTTGGTAGGGCCTAGATTGTACAGCTGTTGTAATTGCCGAAACCATGTTTCACTTCATGATGATATAATTTCTAAGGCTTTTCAGGGAAGACATGGCCGAGCTTTTCTGTTCTCCCACGCGATGAATGTTGTTGTTGGGACAAAAGAAGACAGACATCTGTTGACTGGACTGCATACTGTTGCAGACATCCATTGCGGTGATTGCCGTGAGGTGTTGGGGTGGAAGTATGAACGAGCTTACGAGGCATCACAGAAGTACAAGGAAGGGAAGTTCATATTTGAGAAGTCAAAAATTGTGAAGGAGGATTGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Yippee-Mis18

Protein Analysis

107

Amino Acids

12.21

Weight (kDa)

8.3

Isoelectric Point (pI)

14.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 128
AciI CCGC 2 cut(s) 5, 204
AcoI YGGCCR 1 cut(s) 103
AfaI GTAC 2 cut(s) 29, 266
AloI GAACNNNNNNTCC 2 cut(s) 263, 295
AluBI AGCT 3 cut(s) 33, 110, 245
AluI AGCT 3 cut(s) 33, 110, 245
AoxI GGCC 2 cut(s) 17, 103
AspS9I GGNCC 1 cut(s) 17
AsuHPI GGTGA 1 cut(s) 218
BbsI GAAGAC 2 cut(s) 103, 162
BceAI ACGGC 1 cut(s) 198
BfaI CTAG 1 cut(s) 21
BmgT120I GGNCC 1 cut(s) 17
BmsI GCATC 1 cut(s) 263
BpiI GAAGAC 2 cut(s) 103, 162
BsaXI ACNNNNNCTCC 1 cut(s) 302
Bse1I ACTGG 1 cut(s) 178
Bse3DI GCAATG 1 cut(s) 199
BseGI GGATG 1 cut(s) 195
BseMI GCAATG 1 cut(s) 199
BseNI ACTGG 1 cut(s) 178
Bsh1236I CGCG 1 cut(s) 128
BshFI GGCC 2 cut(s) 19, 105
BslFI GGGAC 1 cut(s) 160
BsmFI GGGAC 1 cut(s) 160
BsnI GGCC 2 cut(s) 19, 105
Bsp1407I TGTACA 1 cut(s) 27
BspACI CCGC 2 cut(s) 5, 204
BspANI GGCC 2 cut(s) 19, 105
BspFNI CGCG 1 cut(s) 128
BspHI TCATGA 1 cut(s) 64
BsrDI GCAATG 1 cut(s) 199
BsrGI TGTACA 1 cut(s) 27
BsrI ACTGG 1 cut(s) 178
Bst4CI ACNGT 1 cut(s) 187
BstAUI TGTACA 1 cut(s) 27
BstDEI CTNAG 1 cut(s) 81
BstF5I GGATG 1 cut(s) 195
BstFNI CGCG 1 cut(s) 128
BstMWI GCNNNNNNNGC 2 cut(s) 210, 251
BstUI CGCG 1 cut(s) 128
BstV2I GAAGAC 2 cut(s) 103, 162
BsuRI GGCC 2 cut(s) 19, 105
BtgZI GCGATG 1 cut(s) 143
BtsCI GGATG 1 cut(s) 195
CciI TCATGA 1 cut(s) 64
Cfr13I GGNCC 1 cut(s) 17
Csp6I GTAC 2 cut(s) 28, 265
CviAII CATG 3 cut(s) 53, 65, 101
CviJI RGCY 6 cut(s) 19, 33, 86, 105, 110, 245
CviKI_1 RGCY 6 cut(s) 19, 33, 86, 105, 110, 245
CviQI GTAC 2 cut(s) 28, 265
DdeI CTNAG 1 cut(s) 81
EaeI YGGCCR 1 cut(s) 103
EciI GGCGGA 1 cut(s) 20
EcoO109I RGGNCCY 1 cut(s) 17
FaeI CATG 3 cut(s) 56, 68, 104
FaiI YATR 7 cut(s) 54, 66, 74, 102, 183, 237, 284
FaqI GGGAC 1 cut(s) 160
FatI CATG 3 cut(s) 52, 64, 100
FokI GGATG 1 cut(s) 182
FspBI CTAG 1 cut(s) 21
HaeIII GGCC 2 cut(s) 19, 105
Hin1II CATG 3 cut(s) 56, 68, 104
HincII GTYRAC 1 cut(s) 171
HindII GTYRAC 1 cut(s) 171
HphI GGTGA 1 cut(s) 218
Hpy166II GTNNAC 1 cut(s) 171
Hpy188III TCNNGA 1 cut(s) 65
Hpy8I GTNNAC 1 cut(s) 171
HpyAV CCTTC 2 cut(s) 266, 301
HpyCH4III ACNGT 1 cut(s) 187
HpyCH4V TGCA 2 cut(s) 181, 191
HpyF10VI GCNNNNNNNGC 2 cut(s) 210, 251
HpyF3I CTNAG 1 cut(s) 81
Hsp92II CATG 3 cut(s) 56, 68, 104
LpnPI CCDG 2 cut(s) 77, 159
LweI GCATC 1 cut(s) 263
MaeI CTAG 1 cut(s) 21
MboII GAAGA 2 cut(s) 108, 167
MluCI AATT 3 cut(s) 40, 75, 300
MnlI CCTC 3 cut(s) 211, 244, 304
MslI CAYNNNNRTG 1 cut(s) 204
MspA1I CMGCKG 1 cut(s) 33
MvnI CGCG 1 cut(s) 128
MwoI GCNNNNNNNGC 2 cut(s) 210, 251
NlaIII CATG 3 cut(s) 56, 68, 104
NmeAIII GCCGAG 1 cut(s) 131
PagI TCATGA 1 cut(s) 64
PspPI GGNCC 1 cut(s) 17
PvuII CAGCTG 1 cut(s) 33
RsaI GTAC 2 cut(s) 29, 266
RsaNI GTAC 2 cut(s) 28, 265
RseI CAYNNNNRTG 1 cut(s) 204
Sau96I GGNCC 1 cut(s) 17
SetI ASST 4 cut(s) 35, 112, 222, 247
SfaNI GCATC 1 cut(s) 263
SmiMI CAYNNNNRTG 1 cut(s) 204
Sse9I AATT 3 cut(s) 40, 75, 300
SsiI CCGC 2 cut(s) 5, 204
SspMI CTAG 1 cut(s) 21
TaaI ACNGT 1 cut(s) 187
TasI AATT 3 cut(s) 40, 75, 300
TatI WGTACW 2 cut(s) 27, 264
TspDTI ATGAA 4 cut(s) 53, 146, 252, 271
XspI CTAG 1 cut(s) 21
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.