RchiOBHm_Chr7g0186701

Belongs to the yippee family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Reverse (-)
6532364 .. 6533916
1553 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ16665

Sequence Viewer

Length: 321 bp
ATGGCGGAATTGGTTGGGCCGAGGTTGTACGGTTGTTGTAATTGCCGAAACCATGTTGCCCTTCACGATGATGTCATCTCTAAAGCCTTTCAGGGAAGAAATGGTCGAGCCTTTCTGTTCTCGCATGCAATGAATATTACAGTCGGCCCTAGAGAAGACCGCCACCTCATGACTGGTCTGCACACGGTTGCGGATGTCTACTGCTGCGACTGCCATGAAGTGCTGGGCTGGAAGTATGAACGAGCCTATGAGGAAACACAGAAATACAAGGAAGGGAAATTCATCCTAGAGAAATCTAAAATAGTCAAGGAAAACTGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

106

Amino Acids

12.28

Weight (kDa)

7.65

Isoelectric Point (pI)

16.82

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Yippee-Mis18 PF03226 10 - 102 3.2e-12 Yippee zinc-binding/DNA-binding /Mis18, centromere assembly
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 198
AciI CCGC 3 cut(s) 5, 160, 191
AcsI RAATTY 1 cut(s) 278
AfaI GTAC 1 cut(s) 29
AoxI GGCC 2 cut(s) 17, 145
ApeKI GCWGC 1 cut(s) 204
ApoI RAATTY 1 cut(s) 278
AspS9I GGNCC 2 cut(s) 17, 146
BbsI GAAGAC 1 cut(s) 162
BbvI GCAGC 1 cut(s) 191
BfaI CTAG 2 cut(s) 150, 287
BisI GCNGC 1 cut(s) 205
BlsI GCNGC 1 cut(s) 206
BmgT120I GGNCC 2 cut(s) 17, 146
BpiI GAAGAC 1 cut(s) 162
BsaJI CCNNGG 1 cut(s) 20
Bse1I ACTGG 2 cut(s) 178, 320
Bse3DI GCAATG 1 cut(s) 135
BseDI CCNNGG 1 cut(s) 20
BseGI GGATG 2 cut(s) 199, 282
BseMI GCAATG 1 cut(s) 135
BseNI ACTGG 2 cut(s) 178, 320
BseXI GCAGC 1 cut(s) 191
BseYI CCCAGC 1 cut(s) 223
BsgI GTGCAG 1 cut(s) 164
BshFI GGCC 2 cut(s) 19, 147
BsnI GGCC 2 cut(s) 19, 147
BspACI CCGC 3 cut(s) 5, 160, 191
BspANI GGCC 2 cut(s) 19, 147
BspHI TCATGA 1 cut(s) 168
BsrDI GCAATG 1 cut(s) 135
BsrI ACTGG 2 cut(s) 178, 320
BssECI CCNNGG 1 cut(s) 20
Bst4CI ACNGT 3 cut(s) 32, 142, 187
BstC8I GCNNGC 1 cut(s) 126
BstF5I GGATG 2 cut(s) 199, 282
BstMWI GCNNNNNNNGC 1 cut(s) 210
BstNSI RCATGY 1 cut(s) 128
BstV1I GCAGC 1 cut(s) 191
BstV2I GAAGAC 1 cut(s) 162
BsuRI GGCC 2 cut(s) 19, 147
BtsCI GGATG 2 cut(s) 199, 282
Cac8I GCNNGC 1 cut(s) 126
CciI TCATGA 1 cut(s) 168
Cfr13I GGNCC 2 cut(s) 17, 146
Csp6I GTAC 1 cut(s) 28
CviAII CATG 4 cut(s) 53, 125, 169, 215
CviJI RGCY 6 cut(s) 19, 86, 110, 147, 228, 245
CviKI_1 RGCY 6 cut(s) 19, 86, 110, 147, 228, 245
CviQI GTAC 1 cut(s) 28
EciI GGCGGA 1 cut(s) 20
FaeI CATG 4 cut(s) 56, 128, 172, 218
FaiI YATR 6 cut(s) 54, 126, 170, 216, 237, 249
FatI CATG 4 cut(s) 52, 124, 168, 214
FblI GTMKAC 1 cut(s) 198
Fnu4HI GCNGC 1 cut(s) 205
FokI GGATG 2 cut(s) 206, 269
Fsp4HI GCNGC 1 cut(s) 205
FspBI CTAG 2 cut(s) 150, 287
GluI GCNGC 1 cut(s) 205
GsaI CCCAGC 1 cut(s) 227
HaeIII GGCC 2 cut(s) 19, 147
Hin1II CATG 4 cut(s) 56, 128, 172, 218
Hpy166II GTNNAC 1 cut(s) 199
Hpy188III TCNNGA 2 cut(s) 65, 169
Hpy8I GTNNAC 1 cut(s) 199
HpyAV CCTTC 2 cut(s) 71, 266
HpyCH4III ACNGT 3 cut(s) 32, 142, 187
HpyCH4V TGCA 2 cut(s) 128, 181
HpyF10VI GCNNNNNNNGC 1 cut(s) 210
Hsp92II CATG 4 cut(s) 56, 128, 172, 218
LpnPI CCDG 5 cut(s) 77, 159, 209, 214, 301
Lsp1109I GCAGC 1 cut(s) 191
MaeI CTAG 2 cut(s) 150, 287
MboII GAAGA 2 cut(s) 108, 167
MluCI AATT 3 cut(s) 8, 40, 278
MnlI CCTC 3 cut(s) 15, 176, 244
MslI CAYNNNNRTG 1 cut(s) 69
MwoI GCNNNNNNNGC 1 cut(s) 210
NlaIII CATG 4 cut(s) 56, 128, 172, 218
NmeAIII GCCGAG 1 cut(s) 45
NspI RCATGY 1 cut(s) 128
PaeI GCATGC 1 cut(s) 128
PagI TCATGA 1 cut(s) 168
PkrI GCNGC 1 cut(s) 206
PspFI CCCAGC 1 cut(s) 223
PspPI GGNCC 2 cut(s) 17, 146
RsaI GTAC 1 cut(s) 29
RsaNI GTAC 1 cut(s) 28
RseI CAYNNNNRTG 1 cut(s) 69
SatI GCNGC 1 cut(s) 205
Sau96I GGNCC 2 cut(s) 17, 146
SetI ASST 2 cut(s) 26, 168
SmiMI CAYNNNNRTG 1 cut(s) 69
SphI GCATGC 1 cut(s) 128
Sse9I AATT 3 cut(s) 8, 40, 278
SsiI CCGC 3 cut(s) 5, 160, 191
SspI AATATT 1 cut(s) 136
SspMI CTAG 2 cut(s) 150, 287
TaaI ACNGT 3 cut(s) 32, 142, 187
TaqI TCGA 1 cut(s) 106
TasI AATT 3 cut(s) 8, 40, 278
TseI GCWGC 1 cut(s) 204
TspDTI ATGAA 4 cut(s) 146, 231, 252, 271
XapI RAATTY 1 cut(s) 278
XceI RCATGY 1 cut(s) 128
XcmI CCANNNNNNNNNTGG 1 cut(s) 170
XmiI GTMKAC 1 cut(s) 198
XspI CTAG 2 cut(s) 150, 287
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.