Rmu_co8409831.1_g000001

Belongs to the yippee family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8409831.1
Physical Location & Seq
Reverse (-)
48 .. 852
805 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8409831.1_g000001.1.cds

Sequence Viewer

Length: 321 bp
atggcggatttggtagggcctagattgtacagctgctgtaattgccgaaaccatgtttcacttcatgatgatatagtttccaaagcctttcagggaaaacacggtcgagcttttctgttctcccatgcgatgaatatagttgttggggcaaaggaagacaggcatctgatgacgggtctgcatactgtggctgacatctcttgcggcgattgccatgaggtgttggggtggaagtatgaaagagcttatgaggcttcacagaagtacaaggaagggaagttcatatttgagaagtcgaaaattgttaaggagggttggtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

106

Amino Acids

12.05

Weight (kDa)

8.29

Isoelectric Point (pI)

18.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 5, 204
AfaI GTAC 2 cut(s) 29, 266
AloI GAACNNNNNNTCC 2 cut(s) 263, 295
AluBI AGCT 3 cut(s) 33, 110, 245
AluI AGCT 3 cut(s) 33, 110, 245
AlwNI CAGNNNCTG 1 cut(s) 36
AoxI GGCC 1 cut(s) 17
ApeKI GCWGC 1 cut(s) 33
AspS9I GGNCC 1 cut(s) 17
BbsI GAAGAC 1 cut(s) 162
BbvI GCAGC 1 cut(s) 20
BfaI CTAG 1 cut(s) 21
BisI GCNGC 2 cut(s) 34, 205
BlsI GCNGC 2 cut(s) 35, 206
BmgT120I GGNCC 1 cut(s) 17
BmsI GCATC 1 cut(s) 172
BpiI GAAGAC 1 cut(s) 162
BsaXI ACNNNNNCTCC 1 cut(s) 302
BseXI GCAGC 1 cut(s) 20
Bsh1285I CGRYCG 1 cut(s) 106
BshFI GGCC 1 cut(s) 19
BsiEI CGRYCG 1 cut(s) 106
BsnI GGCC 1 cut(s) 19
Bsp1407I TGTACA 1 cut(s) 27
BspACI CCGC 2 cut(s) 5, 204
BspANI GGCC 1 cut(s) 19
BspHI TCATGA 1 cut(s) 64
BsrGI TGTACA 1 cut(s) 27
Bst4CI ACNGT 2 cut(s) 104, 187
BstAUI TGTACA 1 cut(s) 27
BstMCI CGRYCG 1 cut(s) 106
BstMWI GCNNNNNNNGC 3 cut(s) 42, 210, 251
BstV1I GCAGC 1 cut(s) 20
BstV2I GAAGAC 1 cut(s) 162
BsuRI GGCC 1 cut(s) 19
BtgZI GCGATG 1 cut(s) 143
CaiI CAGNNNCTG 1 cut(s) 36
CciI TCATGA 1 cut(s) 64
Cfr13I GGNCC 1 cut(s) 17
Csp6I GTAC 2 cut(s) 28, 265
CviAII CATG 4 cut(s) 53, 65, 125, 215
CviJI RGCY 7 cut(s) 19, 33, 86, 110, 191, 245, 254
CviKI_1 RGCY 7 cut(s) 19, 33, 86, 110, 191, 245, 254
CviQI GTAC 2 cut(s) 28, 265
EciI GGCGGA 1 cut(s) 20
EcoO109I RGGNCCY 1 cut(s) 17
FaeI CATG 4 cut(s) 56, 68, 128, 218
FatI CATG 4 cut(s) 52, 64, 124, 214
Fnu4HI GCNGC 2 cut(s) 34, 205
Fsp4HI GCNGC 2 cut(s) 34, 205
FspBI CTAG 1 cut(s) 21
GluI GCNGC 2 cut(s) 34, 205
HaeIII GGCC 1 cut(s) 19
Hin1II CATG 4 cut(s) 56, 68, 128, 218
Hpy188I TCNGA 1 cut(s) 168
Hpy188III TCNNGA 1 cut(s) 65
HpyAV CCTTC 1 cut(s) 266
HpyCH4III ACNGT 2 cut(s) 104, 187
HpyCH4V TGCA 1 cut(s) 181
HpyF10VI GCNNNNNNNGC 3 cut(s) 42, 210, 251
Hsp92II CATG 4 cut(s) 56, 68, 128, 218
LpnPI CCDG 2 cut(s) 77, 145
Lsp1109I GCAGC 1 cut(s) 20
LweI GCATC 1 cut(s) 172
MaeI CTAG 1 cut(s) 21
MboII GAAGA 1 cut(s) 167
MluCI AATT 2 cut(s) 40, 300
MnlI CCTC 3 cut(s) 211, 244, 304
MseI TTAA 1 cut(s) 306
MspA1I CMGCKG 1 cut(s) 33
MwoI GCNNNNNNNGC 3 cut(s) 42, 210, 251
NlaIII CATG 4 cut(s) 56, 68, 128, 218
PagI TCATGA 1 cut(s) 64
PkrI GCNGC 2 cut(s) 35, 206
PspPI GGNCC 1 cut(s) 17
PstNI CAGNNNCTG 1 cut(s) 36
PvuII CAGCTG 1 cut(s) 33
RsaI GTAC 2 cut(s) 29, 266
RsaNI GTAC 2 cut(s) 28, 265
SaqAI TTAA 1 cut(s) 306
SatI GCNGC 2 cut(s) 34, 205
Sau96I GGNCC 1 cut(s) 17
SetI ASST 4 cut(s) 35, 112, 222, 247
SfaNI GCATC 1 cut(s) 172
Sse9I AATT 2 cut(s) 40, 300
SsiI CCGC 2 cut(s) 5, 204
SspMI CTAG 1 cut(s) 21
TaaI ACNGT 2 cut(s) 104, 187
TaqI TCGA 2 cut(s) 106, 296
TasI AATT 2 cut(s) 40, 300
TatI WGTACW 2 cut(s) 27, 264
TauI GCSGC 1 cut(s) 207
Tru1I TTAA 1 cut(s) 306
Tru9I TTAA 1 cut(s) 306
TseI GCWGC 1 cut(s) 33
TspDTI ATGAA 4 cut(s) 53, 146, 252, 271
XspI CTAG 1 cut(s) 21
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.