FvH4_c17g00090

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
contig_17
Physical Location & Seq
Reverse (-)
78140 .. 81435
3296 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_c17g00090.t21

Sequence Viewer

Length: 201 bp
ATGCTTGGTTCTGGTTTCTTTTGGGTGATTTCCAATTCATCAGTTCTCAAGGTAATGGAGAGGGTCATCCCATTTCCAGTTAGCCATTGTCCCAAAATAACTACAATGAACGCCAAAGGCAGTAGAAAGATTTGGAGGAGGAACTTAATTGCAGGTTGTGGTCAAGGTTGCTGTGATTTTGTTGATCAGTATATAAACTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.41

Weight (kDa)

9.43

Isoelectric Point (pI)

28.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 143
AsuHPI GGTGA 1 cut(s) 37
BclI TGATCA 1 cut(s) 184
BfuAI ACCTGC 1 cut(s) 143
BpuEI CTTGAG 1 cut(s) 32
Bse1I ACTGG 1 cut(s) 77
BseGI GGATG 1 cut(s) 66
BseNI ACTGG 1 cut(s) 77
BseRI GAGGAG 1 cut(s) 151
BslFI GGGAC 1 cut(s) 75
BsmFI GGGAC 1 cut(s) 75
Bsp143I GATC 1 cut(s) 184
BspMI ACCTGC 1 cut(s) 143
BsrI ACTGG 1 cut(s) 77
BssMI GATC 1 cut(s) 184
BstF5I GGATG 1 cut(s) 66
BstKTI GATC 1 cut(s) 187
BstMBI GATC 1 cut(s) 184
BtsCI GGATG 1 cut(s) 66
BveI ACCTGC 1 cut(s) 143
CviJI RGCY 1 cut(s) 84
CviKI_1 RGCY 1 cut(s) 84
DpnI GATC 1 cut(s) 186
DpnII GATC 1 cut(s) 184
FaiI YATR 2 cut(s) 192, 194
FaqI GGGAC 1 cut(s) 75
FbaI TGATCA 1 cut(s) 184
FokI GGATG 1 cut(s) 53
HphI GGTGA 1 cut(s) 37
HpyCH4V TGCA 1 cut(s) 152
Ksp22I TGATCA 1 cut(s) 184
Kzo9I GATC 1 cut(s) 184
LpnPI CCDG 2 cut(s) 90, 138
MalI GATC 1 cut(s) 186
MboI GATC 1 cut(s) 184
MluCI AATT 2 cut(s) 34, 147
MnlI CCTC 3 cut(s) 54, 129, 132
MseI TTAA 1 cut(s) 146
NdeII GATC 1 cut(s) 184
SaqAI TTAA 1 cut(s) 146
Sau3AI GATC 1 cut(s) 184
SetI ASST 3 cut(s) 54, 157, 169
SgeI CNNG 6 cut(s) 17, 24, 61, 89, 165, 176
SmlI CTYRAG 1 cut(s) 47
SmoI CTYRAG 1 cut(s) 47
Sse9I AATT 2 cut(s) 34, 147
TasI AATT 2 cut(s) 34, 147
Tru1I TTAA 1 cut(s) 146
Tru9I TTAA 1 cut(s) 146
TspDTI ATGAA 2 cut(s) 27, 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.