MD03G1046400.v1.1

bis(5'-adenosyl)-triphosphatase activity

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr03
Physical Location & Seq
Reverse (-)
3727836 .. 3728363
528 bp
Loading structure...
UTR
Exon/CDS
Intron
MD03G1046400.v1.1.491

Sequence Viewer

Length: 261 bp
ATGGCTTCGGAGAGCTTCAAGTTCGGGCCGTACAATATCGACAGTAGGGAAGTATTCTACTCCACCAAGCTATCCTACGCCCTGGTTAACCTGCGCCCTCTTGTTCCTGGTACTTTTCTCTTACTCTTAACACTGAATAATCAAAGCATGAAAATTGGATGTAGAAATTGCAAATTTGATGACCCAACTCTCCTTTTTCTTTGCAGGTCATATCCTTTTATTTGCTTTGGATATGAATTTTGTTTTGAGATCGGTGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

87

Amino Acids

9.95

Weight (kDa)

6.19

Isoelectric Point (pI)

50.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 2 cut(s) 99, 195
AcsI RAATTY 2 cut(s) 173, 236
AfaI GTAC 2 cut(s) 32, 112
AgsI TTSAA 1 cut(s) 19
AjnI CCWGG 2 cut(s) 81, 106
AluBI AGCT 2 cut(s) 15, 70
AluI AGCT 2 cut(s) 15, 70
AoxI GGCC 1 cut(s) 26
ApoI RAATTY 2 cut(s) 173, 236
AspLEI GCGC 1 cut(s) 96
AspS9I GGNCC 1 cut(s) 26
BceAI ACGGC 1 cut(s) 13
BciT130I CCWGG 2 cut(s) 83, 108
BfuAI ACCTGC 2 cut(s) 99, 195
Bme1390I CCNGG 2 cut(s) 83, 108
BmgT120I GGNCC 1 cut(s) 26
BmrFI CCNGG 2 cut(s) 83, 108
BsaJI CCNNGG 1 cut(s) 81
BseBI CCWGG 2 cut(s) 83, 108
BseDI CCNNGG 1 cut(s) 81
BseGI GGATG 1 cut(s) 164
BshFI GGCC 1 cut(s) 28
BsnI GGCC 1 cut(s) 28
Bsp143I GATC 1 cut(s) 249
BspANI GGCC 1 cut(s) 28
BspMI ACCTGC 2 cut(s) 99, 195
BssECI CCNNGG 1 cut(s) 81
BssMI GATC 1 cut(s) 249
Bst2UI CCWGG 2 cut(s) 83, 108
Bst4CI ACNGT 1 cut(s) 44
BstF5I GGATG 1 cut(s) 164
BstHHI GCGC 1 cut(s) 96
BstKTI GATC 1 cut(s) 252
BstMBI GATC 1 cut(s) 249
BstNI CCWGG 2 cut(s) 83, 108
BstSCI CCNGG 2 cut(s) 81, 106
BsuRI GGCC 1 cut(s) 28
BtsCI GGATG 1 cut(s) 164
BtsIMutI CAGTG 1 cut(s) 131
BveI ACCTGC 2 cut(s) 99, 195
CfoI GCGC 1 cut(s) 96
Cfr13I GGNCC 1 cut(s) 26
Csp6I GTAC 2 cut(s) 31, 111
CviAII CATG 1 cut(s) 148
CviJI RGCY 4 cut(s) 5, 15, 28, 70
CviKI_1 RGCY 4 cut(s) 5, 15, 28, 70
CviQI GTAC 2 cut(s) 31, 111
DpnI GATC 1 cut(s) 251
DpnII GATC 1 cut(s) 249
EcoRII CCWGG 2 cut(s) 81, 106
FaeI CATG 1 cut(s) 151
FaiI YATR 3 cut(s) 149, 211, 234
FatI CATG 1 cut(s) 147
FokI GGATG 1 cut(s) 171
GlaI GCGC 1 cut(s) 95
HaeIII GGCC 1 cut(s) 28
HhaI GCGC 1 cut(s) 96
Hin1II CATG 1 cut(s) 151
Hin6I GCGC 1 cut(s) 94
HinP1I GCGC 1 cut(s) 94
HincII GTYRAC 1 cut(s) 88
HindII GTYRAC 1 cut(s) 88
HpaI GTTAAC 1 cut(s) 88
Hpy166II GTNNAC 1 cut(s) 88
Hpy188I TCNGA 1 cut(s) 10
Hpy8I GTNNAC 1 cut(s) 88
HpyCH4III ACNGT 1 cut(s) 44
HpyCH4V TGCA 2 cut(s) 171, 204
Hsp92II CATG 1 cut(s) 151
HspAI GCGC 1 cut(s) 94
KspAI GTTAAC 1 cut(s) 88
Kzo9I GATC 1 cut(s) 249
LpnPI CCDG 6 cut(s) 68, 93, 95, 104, 120, 190
MalI GATC 1 cut(s) 251
MboI GATC 1 cut(s) 249
MluCI AATT 4 cut(s) 153, 166, 173, 236
MnlI CCTC 1 cut(s) 108
MseI TTAA 2 cut(s) 87, 128
MspR9I CCNGG 2 cut(s) 83, 108
MvaI CCWGG 2 cut(s) 83, 108
NdeII GATC 1 cut(s) 249
NlaIII CATG 1 cut(s) 151
Psp6I CCWGG 2 cut(s) 81, 106
PspGI CCWGG 2 cut(s) 81, 106
PspPI GGNCC 1 cut(s) 26
RsaI GTAC 2 cut(s) 32, 112
RsaNI GTAC 2 cut(s) 31, 111
SaqAI TTAA 2 cut(s) 87, 128
Sau3AI GATC 1 cut(s) 249
Sau96I GGNCC 1 cut(s) 26
ScrFI CCNGG 2 cut(s) 83, 108
SetI ASST 4 cut(s) 17, 72, 93, 209
Sse9I AATT 4 cut(s) 153, 166, 173, 236
StyD4I CCNGG 2 cut(s) 81, 106
TaaI ACNGT 1 cut(s) 44
TaqI TCGA 1 cut(s) 39
TasI AATT 4 cut(s) 153, 166, 173, 236
Tru1I TTAA 2 cut(s) 87, 128
Tru9I TTAA 2 cut(s) 87, 128
TscAI CASTG 1 cut(s) 138
TspDTI ATGAA 2 cut(s) 164, 249
TspRI CASTG 1 cut(s) 138
XapI RAATTY 2 cut(s) 173, 236
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.