MD03G1160400.v1.1

Aldolase/RraA

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr03
OG0001631
Physical Location & Seq
Forward (+)
19218661 .. 19218891
231 bp
Loading structure...
UTR
Exon/CDS
Intron
MD03G1160400.v1.1.491

Sequence Viewer

Length: 231 bp
ATGGGTTGGTCTGGGATTGTGATAAATGGGTGCATCAGATATGTTGATGAGGTAAATGGATGTGAGATTGGTGTGAGAGCTTTGGCAACTTGTCTTGTGAGACCAATCAAAAGTGATGGTGGCCAAAAGCATGTTCCTATCAATATTGGAGGAATCTGGATTCATGAAGGAGAATGGTTGTATGCAGATGGCGATGGCATCCTCGTCTCCACATCTCAATTGTCTATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RraA-like

Protein Analysis

77

Amino Acids

8.15

Weight (kDa)

5.04

Isoelectric Point (pI)

25.49

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RraA-like PF03737 2 - 69 2.4e-19 Aldolase/RraA
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 121
AjuI GAANNNNNNNTTGG 2 cut(s) 117, 149
AluBI AGCT 1 cut(s) 80
AluI AGCT 1 cut(s) 80
Alw26I GTCTC 2 cut(s) 94, 211
AoxI GGCC 1 cut(s) 121
BalI TGGCCA 1 cut(s) 123
BccI CCATC 3 cut(s) 110, 182, 188
BcoDI GTCTC 2 cut(s) 94, 211
BmsI GCATC 2 cut(s) 42, 207
BsaI GGTCTC 1 cut(s) 94
BseGI GGATG 2 cut(s) 65, 198
BshFI GGCC 1 cut(s) 123
BsmAI GTCTC 2 cut(s) 94, 211
BsmBI CGTCTC 1 cut(s) 211
BsnI GGCC 1 cut(s) 123
Bso31I GGTCTC 1 cut(s) 94
BspANI GGCC 1 cut(s) 123
BspHI TCATGA 1 cut(s) 163
BspTNI GGTCTC 1 cut(s) 94
BstF5I GGATG 2 cut(s) 65, 198
BstMAI GTCTC 2 cut(s) 94, 211
BstNSI RCATGY 1 cut(s) 134
BsuRI GGCC 1 cut(s) 123
BtgZI GCGATG 1 cut(s) 207
BtsCI GGATG 2 cut(s) 65, 198
CciI TCATGA 1 cut(s) 163
CviAII CATG 2 cut(s) 131, 164
CviJI RGCY 2 cut(s) 80, 123
CviKI_1 RGCY 2 cut(s) 80, 123
EaeI YGGCCR 1 cut(s) 121
Eco31I GGTCTC 1 cut(s) 94
Esp3I CGTCTC 1 cut(s) 211
FaeI CATG 2 cut(s) 134, 167
FaiI YATR 4 cut(s) 42, 132, 165, 183
FatI CATG 2 cut(s) 130, 163
FokI GGATG 2 cut(s) 72, 185
HaeIII GGCC 1 cut(s) 123
Hin1II CATG 2 cut(s) 134, 167
HinfI GANTC 2 cut(s) 153, 160
Hpy188I TCNGA 1 cut(s) 38
Hpy188III TCNNGA 2 cut(s) 157, 164
HpyAV CCTTC 1 cut(s) 161
HpyCH4V TGCA 2 cut(s) 33, 185
Hsp92II CATG 2 cut(s) 134, 167
LpnPI CCDG 1 cut(s) 142
LweI GCATC 2 cut(s) 42, 207
MfeI CAATTG 1 cut(s) 218
MlsI TGGCCA 1 cut(s) 123
MluCI AATT 1 cut(s) 218
MluNI TGGCCA 1 cut(s) 123
MnlI CCTC 3 cut(s) 43, 143, 212
Mox20I TGGCCA 1 cut(s) 123
MscI TGGCCA 1 cut(s) 123
Msp20I TGGCCA 1 cut(s) 123
MunI CAATTG 1 cut(s) 218
NlaIII CATG 2 cut(s) 134, 167
NspI RCATGY 1 cut(s) 134
PagI TCATGA 1 cut(s) 163
PfeI GAWTC 2 cut(s) 153, 160
SetI ASST 2 cut(s) 54, 82
SfaNI GCATC 2 cut(s) 42, 207
SgeI CNNG 7 cut(s) 24, 102, 107, 143, 169, 176, 215
Sse9I AATT 1 cut(s) 218
SspI AATATT 1 cut(s) 145
TasI AATT 1 cut(s) 218
TfiI GAWTC 2 cut(s) 153, 160
TspDTI ATGAA 2 cut(s) 152, 180
XceI RCATGY 1 cut(s) 134
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.