Rh6DG387500

Aldolase/RraA

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
OG0001631
Physical Location & Seq
Reverse (-)
58033009 .. 58033221
213 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG387500.1

Sequence Viewer

Length: 213 bp
ATGAGACGTGCCGTCACCGGAGGGATGCTGGCCAAGTGTGCCGAGATTATGGGGTGGGCTGGGATTGTGGTGAATGGGTGCGTAAGAGATGTGGATGAGATCAATGAATGTGAGATCGGGGTGAGAGCTTTGGCGACTTGTCCGGTGAGACCGATTGAAGGTGAAGATGGGAGTGGCCAGAAGCATGTTGATGTCAACATTGGAGGAACATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RraA-like

Protein Analysis

70

Amino Acids

7.33

Weight (kDa)

4.91

Isoelectric Point (pI)

43.54

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RraA-like PF03737 3 - 69 1.7e-17 Aldolase/RraA
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 2 cut(s) 30, 175
AfiI CCNNNNNNNGG 1 cut(s) 158
AgsI TTSAA 1 cut(s) 158
AhdI GACNNNNNGTC 1 cut(s) 11
AjiI CACGTC 1 cut(s) 8
AluBI AGCT 1 cut(s) 128
AluI AGCT 1 cut(s) 128
Alw26I GTCTC 1 cut(s) 142
AoxI GGCC 2 cut(s) 30, 175
AsuHPI GGTGA 5 cut(s) 7, 82, 133, 157, 173
BalI TGGCCA 2 cut(s) 32, 177
BccI CCATC 1 cut(s) 161
BcoDI GTCTC 1 cut(s) 142
BmeRI GACNNNNNGTC 1 cut(s) 11
BmgBI CACGTC 1 cut(s) 8
BmsI GCATC 1 cut(s) 15
BsaI GGTCTC 1 cut(s) 142
BsaWI WCCGGW 2 cut(s) 17, 142
Bsc4I CCNNNNNNNGG 1 cut(s) 158
BseGI GGATG 2 cut(s) 30, 100
BseLI CCNNNNNNNGG 1 cut(s) 158
BseYI CCCAGC 1 cut(s) 59
BshFI GGCC 2 cut(s) 32, 177
BsiSI CCGG 2 cut(s) 18, 143
BslI CCNNNNNNNGG 1 cut(s) 158
BsmAI GTCTC 1 cut(s) 142
BsnI GGCC 2 cut(s) 32, 177
Bso31I GGTCTC 1 cut(s) 142
Bsp143I GATC 2 cut(s) 99, 114
BspANI GGCC 2 cut(s) 32, 177
BspTNI GGTCTC 1 cut(s) 142
BssMI GATC 2 cut(s) 99, 114
BstC8I GCNNGC 1 cut(s) 30
BstF5I GGATG 2 cut(s) 30, 100
BstKTI GATC 2 cut(s) 102, 117
BstMAI GTCTC 1 cut(s) 142
BstMBI GATC 2 cut(s) 99, 114
BstMWI GCNNNNNNNGC 1 cut(s) 38
BstNSI RCATGY 1 cut(s) 188
BsuRI GGCC 2 cut(s) 32, 177
BtrI CACGTC 1 cut(s) 8
BtsCI GGATG 2 cut(s) 30, 100
Cac8I GCNNGC 1 cut(s) 30
CviAII CATG 2 cut(s) 185, 210
CviJI RGCY 4 cut(s) 32, 59, 128, 177
CviKI_1 RGCY 4 cut(s) 32, 59, 128, 177
DpnI GATC 2 cut(s) 101, 116
DpnII GATC 2 cut(s) 99, 114
DriI GACNNNNNGTC 1 cut(s) 11
EaeI YGGCCR 2 cut(s) 30, 175
Eam1105I GACNNNNNGTC 1 cut(s) 11
Eco31I GGTCTC 1 cut(s) 142
FaeI CATG 2 cut(s) 188, 213
FaiI YATR 3 cut(s) 50, 186, 211
FatI CATG 2 cut(s) 184, 209
FokI GGATG 2 cut(s) 37, 107
GsaI CCCAGC 1 cut(s) 63
HaeIII GGCC 2 cut(s) 32, 177
HapII CCGG 2 cut(s) 18, 143
Hin1II CATG 2 cut(s) 188, 213
HincII GTYRAC 1 cut(s) 196
HindII GTYRAC 1 cut(s) 196
HpaII CCGG 2 cut(s) 18, 143
HphI GGTGA 5 cut(s) 7, 82, 133, 157, 173
Hpy166II GTNNAC 1 cut(s) 196
Hpy8I GTNNAC 1 cut(s) 196
HpyAV CCTTC 1 cut(s) 152
HpyCH4IV ACGT 1 cut(s) 7
HpyF10VI GCNNNNNNNGC 1 cut(s) 38
HpySE526I ACGT 1 cut(s) 7
Hsp92II CATG 2 cut(s) 188, 213
Kzo9I GATC 2 cut(s) 99, 114
LpnPI CCDG 5 cut(s) 14, 31, 45, 156, 191
LweI GCATC 1 cut(s) 15
MaeII ACGT 1 cut(s) 7
MaeIII GTNAC 1 cut(s) 13
MalI GATC 2 cut(s) 101, 116
MboI GATC 2 cut(s) 99, 114
MboII GAAGA 1 cut(s) 176
MlsI TGGCCA 2 cut(s) 32, 177
MluNI TGGCCA 2 cut(s) 32, 177
MnlI CCTC 2 cut(s) 14, 197
Mox20I TGGCCA 2 cut(s) 32, 177
MscI TGGCCA 2 cut(s) 32, 177
MslI CAYNNNNRTG 1 cut(s) 189
Msp20I TGGCCA 2 cut(s) 32, 177
MspI CCGG 2 cut(s) 18, 143
MwoI GCNNNNNNNGC 1 cut(s) 38
NdeII GATC 2 cut(s) 99, 114
NlaIII CATG 2 cut(s) 188, 213
NmeAIII GCCGAG 1 cut(s) 67
NmuCI GTSAC 1 cut(s) 13
NspI RCATGY 1 cut(s) 188
PspFI CCCAGC 1 cut(s) 59
RseI CAYNNNNRTG 1 cut(s) 189
Sau3AI GATC 2 cut(s) 99, 114
SetI ASST 3 cut(s) 10, 130, 163
SfaNI GCATC 1 cut(s) 15
SmiMI CAYNNNNRTG 1 cut(s) 189
TaiI ACGT 1 cut(s) 10
TaqII GACCGA 1 cut(s) 166
TseFI GTSAC 1 cut(s) 13
Tsp45I GTSAC 1 cut(s) 13
TspDTI ATGAA 1 cut(s) 120
XceI RCATGY 1 cut(s) 188
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.