Rmu_sc0004706.1_g000018

Catalyzes the aldol cleavage of 4-hydroxy-4-methyl-2- oxoglutarate (HMG) into 2 molecules of pyruvate. Also contains a secondary oxaloacetate (OAA) decarboxylase activity due to the common pyruvate enolate transition state formed following C-C bond cleavage in the retro-aldol and decarboxylation reactions

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004706.1
Physical Location & Seq
Reverse (-)
61191 .. 61691
501 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004706.1_g000018.1.cds

Sequence Viewer

Length: 501 bp
atggctttcttagcaactgctgaactttgtgatacaaatacagctcttttgggaagtggagatttgcgtgtcctgccaccaatatttcagatgtatggacaacgtcgagcattctcaggccccatttccactgttaaggtttttgaggacaacgttttggttagagagcttgtcggaaccagagtcgagggaagagttttagttattgatgggggaggaagcttgagaagtgctttgcttggagggattttgtcacagttggctcaaaacatgggatgggcagggattgtgataaatggctgcattagagatgtagatgagatcaatggatgtgatattggggtgagagctttggcatctcatcccgtgaagcccggcaaaagaggccatggcaataagcatgttccgatcaacattgcaggaaccttgatccgcgaaggggaatggttgtatgctgatagtgatggcatccttgtctccacatctgaattgtctatctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

166

Amino Acids

17.61

Weight (kDa)

5.89

Isoelectric Point (pI)

31.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 435
AciI CCGC 1 cut(s) 433
AclI AACGTT 1 cut(s) 153
AclWI GGATC 1 cut(s) 424
AfiI CCNNNNNNNGG 1 cut(s) 439
AluBI AGCT 4 cut(s) 44, 169, 222, 350
AluI AGCT 4 cut(s) 44, 169, 222, 350
Alw26I GTCTC 1 cut(s) 481
AlwI GGATC 1 cut(s) 424
AoxI GGCC 2 cut(s) 118, 385
ApeKI GCWGC 1 cut(s) 300
AspS9I GGNCC 1 cut(s) 119
AsuC2I CCSGG 1 cut(s) 375
AsuHPI GGTGA 1 cut(s) 355
BbvI GCAGC 1 cut(s) 287
BccI CCATC 3 cut(s) 203, 270, 458
BcnI CCSGG 1 cut(s) 375
BcoDI GTCTC 1 cut(s) 481
BisI GCNGC 1 cut(s) 301
BlsI GCNGC 1 cut(s) 302
Bme1390I CCNGG 1 cut(s) 375
BmgT120I GGNCC 1 cut(s) 119
BmiI GGNNCC 3 cut(s) 121, 178, 424
BmrFI CCNGG 1 cut(s) 375
BmsI GCATC 2 cut(s) 365, 477
BpuEI CTTGAG 1 cut(s) 244
BpuMI CCSGG 1 cut(s) 375
BsaJI CCNNGG 1 cut(s) 388
Bsc4I CCNNNNNNNGG 1 cut(s) 439
Bse3DI GCAATG 1 cut(s) 414
BseDI CCNNGG 1 cut(s) 388
BseGI GGATG 4 cut(s) 281, 335, 361, 468
BseLI CCNNNNNNNGG 1 cut(s) 439
BseMI GCAATG 1 cut(s) 414
BseMII CTCAG 1 cut(s) 129
BseXI GCAGC 1 cut(s) 287
Bsh1236I CGCG 1 cut(s) 435
BshFI GGCC 2 cut(s) 120, 387
BsiSI CCGG 1 cut(s) 375
BslI CCNNNNNNNGG 1 cut(s) 439
BsmAI GTCTC 1 cut(s) 481
BsmI GAATGC 1 cut(s) 110
BsnI GGCC 2 cut(s) 120, 387
Bsp143I GATC 3 cut(s) 321, 408, 429
Bsp19I CCATGG 1 cut(s) 388
BspACI CCGC 1 cut(s) 433
BspANI GGCC 2 cut(s) 120, 387
BspCNI CTCAG 1 cut(s) 128
BspFNI CGCG 1 cut(s) 435
BspLI GGNNCC 3 cut(s) 121, 178, 424
BspPI GGATC 1 cut(s) 424
BsrDI GCAATG 1 cut(s) 414
BssECI CCNNGG 1 cut(s) 388
BssMI GATC 3 cut(s) 321, 408, 429
BssT1I CCWWGG 1 cut(s) 388
Bst4CI ACNGT 2 cut(s) 133, 258
Bst6I CTCTTC 1 cut(s) 187
BstDEI CTNAG 2 cut(s) 10, 115
BstDSI CCRYGG 1 cut(s) 388
BstF5I GGATG 4 cut(s) 281, 335, 361, 468
BstFNI CGCG 1 cut(s) 435
BstKTI GATC 3 cut(s) 324, 411, 432
BstMAI GTCTC 1 cut(s) 481
BstMBI GATC 3 cut(s) 321, 408, 429
BstMWI GCNNNNNNNGC 3 cut(s) 11, 73, 384
BstNSI RCATGY 1 cut(s) 404
BstSCI CCNGG 1 cut(s) 373
BstUI CGCG 1 cut(s) 435
BstV1I GCAGC 1 cut(s) 287
BsuRI GGCC 2 cut(s) 120, 387
BtgI CCRYGG 1 cut(s) 388
BtsCI GGATG 4 cut(s) 281, 335, 361, 468
BtsIMutI CAGTG 1 cut(s) 129
Cfr13I GGNCC 1 cut(s) 119
CviAII CATG 3 cut(s) 271, 389, 401
DdeI CTNAG 2 cut(s) 10, 115
DpnI GATC 3 cut(s) 323, 410, 431
DpnII GATC 3 cut(s) 321, 408, 429
Eam1104I CTCTTC 1 cut(s) 187
EarI CTCTTC 1 cut(s) 187
Eco130I CCWWGG 1 cut(s) 388
EcoO109I RGGNCCY 1 cut(s) 119
EcoT14I CCWWGG 1 cut(s) 388
ErhI CCWWGG 1 cut(s) 388
FaeI CATG 3 cut(s) 274, 392, 404
FaiI YATR 5 cut(s) 96, 272, 390, 402, 453
FatI CATG 3 cut(s) 270, 388, 400
Fnu4HI GCNGC 1 cut(s) 301
FokI GGATG 4 cut(s) 288, 342, 348, 455
Fsp4HI GCNGC 1 cut(s) 301
GluI GCNGC 1 cut(s) 301
HaeIII GGCC 2 cut(s) 120, 387
HapII CCGG 1 cut(s) 375
Hin1II CATG 3 cut(s) 274, 392, 404
HindIII AAGCTT 1 cut(s) 220
HinfI GANTC 1 cut(s) 183
HpaII CCGG 1 cut(s) 375
HphI GGTGA 1 cut(s) 355
Hpy188I TCNGA 5 cut(s) 90, 176, 408, 487, 500
Hpy99I CGWCG 1 cut(s) 108
HpyAV CCTTC 1 cut(s) 431
HpyCH4III ACNGT 2 cut(s) 133, 258
HpyCH4IV ACGT 2 cut(s) 103, 153
HpyCH4V TGCA 2 cut(s) 303, 419
HpyF10VI GCNNNNNNNGC 3 cut(s) 11, 73, 384
HpyF3I CTNAG 2 cut(s) 10, 115
HpySE526I ACGT 2 cut(s) 103, 153
Hsp92II CATG 3 cut(s) 274, 392, 404
Kzo9I GATC 3 cut(s) 321, 408, 429
LpnPI CCDG 6 cut(s) 86, 102, 193, 267, 388, 405
Lsp1109I GCAGC 1 cut(s) 287
LweI GCATC 2 cut(s) 365, 477
MaeII ACGT 2 cut(s) 103, 153
MaeIII GTNAC 1 cut(s) 252
MalI GATC 3 cut(s) 323, 410, 431
MboI GATC 3 cut(s) 321, 408, 429
MboII GAAGA 1 cut(s) 204
MluCI AATT 1 cut(s) 488
MlyI GAGTC 1 cut(s) 192
MmeI TCCRAC 1 cut(s) 154
MnlI CCTC 5 cut(s) 139, 181, 209, 236, 377
MseI TTAA 1 cut(s) 135
MspI CCGG 1 cut(s) 375
MspR9I CCNGG 1 cut(s) 375
Mva1269I GAATGC 1 cut(s) 110
MvnI CGCG 1 cut(s) 435
MwoI GCNNNNNNNGC 3 cut(s) 11, 73, 384
NciI CCSGG 1 cut(s) 375
NcoI CCATGG 1 cut(s) 388
NdeII GATC 3 cut(s) 321, 408, 429
NlaIII CATG 3 cut(s) 274, 392, 404
NlaIV GGNNCC 3 cut(s) 121, 178, 424
NmuCI GTSAC 1 cut(s) 252
NspI RCATGY 1 cut(s) 404
PctI GAATGC 1 cut(s) 110
PflFI GACNNNGTC 1 cut(s) 102
PkrI GCNGC 1 cut(s) 302
PleI GAGTC 1 cut(s) 191
PpsI GAGTC 1 cut(s) 191
Psp1406I AACGTT 1 cut(s) 153
PspN4I GGNNCC 3 cut(s) 121, 178, 424
PspPI GGNCC 1 cut(s) 119
PsyI GACNNNGTC 1 cut(s) 102
SaqAI TTAA 1 cut(s) 135
SatI GCNGC 1 cut(s) 301
Sau3AI GATC 3 cut(s) 321, 408, 429
Sau96I GGNCC 1 cut(s) 119
SchI GAGTC 1 cut(s) 192
ScrFI CCNGG 1 cut(s) 375
SetI ASST 8 cut(s) 46, 106, 141, 156, 171, 224, 352, 428
SfaNI GCATC 2 cut(s) 365, 477
SmlI CTYRAG 1 cut(s) 223
SmoI CTYRAG 1 cut(s) 223
Sse9I AATT 1 cut(s) 488
SsiI CCGC 1 cut(s) 433
SspI AATATT 1 cut(s) 84
StyD4I CCNGG 1 cut(s) 373
StyI CCWWGG 1 cut(s) 388
TaaI ACNGT 2 cut(s) 133, 258
TaiI ACGT 2 cut(s) 106, 156
TaqI TCGA 2 cut(s) 106, 186
TasI AATT 1 cut(s) 488
Tru1I TTAA 1 cut(s) 135
Tru9I TTAA 1 cut(s) 135
TscAI CASTG 1 cut(s) 136
TseFI GTSAC 1 cut(s) 252
TseI GCWGC 1 cut(s) 300
Tsp45I GTSAC 1 cut(s) 252
TspRI CASTG 1 cut(s) 136
Tth111I GACNNNGTC 1 cut(s) 102
XceI RCATGY 1 cut(s) 404
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.