MD04G1188100.v1.1

INO80 complex subunit D-like

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr04
Physical Location & Seq
Forward (+)
27861443 .. 27865142
3700 bp
Loading structure...
UTR
Exon/CDS
Intron
MD04G1188100.v1.1.491

Sequence Viewer

Length: 186 bp
ATGAACCAGAAGAATATCAAGAAGGCCTTGAAGAAGGCAGGCTTTAATAATACCTTATCAAGTAAGTTTGCTCCGATGTTCTATGTCGTAAGAGCAGAATGCGTACGCCAAACCAGGCCAAACGAAGAACGACACAAAACGCAAAGGGAAAAAAAAGTTGCAATTAAGGAAGAAAATGCTGACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

62

Amino Acids

7.15

Weight (kDa)

10.08

Isoelectric Point (pI)

46.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 105
AgsI TTSAA 1 cut(s) 31
AjnI CCWGG 1 cut(s) 113
AoxI GGCC 2 cut(s) 24, 116
BciT130I CCWGG 1 cut(s) 115
Bme1390I CCNGG 1 cut(s) 115
BmrFI CCNGG 1 cut(s) 115
BseBI CCWGG 1 cut(s) 115
BshFI GGCC 2 cut(s) 26, 118
BsiWI CGTACG 1 cut(s) 103
BsmI GAATGC 1 cut(s) 104
BsnI GGCC 2 cut(s) 26, 118
BspANI GGCC 2 cut(s) 26, 118
Bst2UI CCWGG 1 cut(s) 115
BstC8I GCNNGC 1 cut(s) 40
BstNI CCWGG 1 cut(s) 115
BstSCI CCNGG 1 cut(s) 113
BsuRI GGCC 2 cut(s) 26, 118
Cac8I GCNNGC 1 cut(s) 40
Csp6I GTAC 1 cut(s) 104
CviJI RGCY 3 cut(s) 26, 42, 118
CviKI_1 RGCY 3 cut(s) 26, 42, 118
CviQI GTAC 1 cut(s) 104
Eco147I AGGCCT 1 cut(s) 26
EcoRII CCWGG 1 cut(s) 113
FaiI YATR 1 cut(s) 84
FalI AAGNNNNNCTT 4 cut(s) 11, 43, 26, 58
HaeIII GGCC 2 cut(s) 26, 118
Hpy188I TCNGA 1 cut(s) 75
Hpy188III TCNNGA 1 cut(s) 19
HpyAV CCTTC 2 cut(s) 16, 28
HpyCH4V TGCA 1 cut(s) 161
LmnI GCTCC 1 cut(s) 76
LpnPI CCDG 4 cut(s) 20, 24, 100, 127
MboII GAAGA 4 cut(s) 22, 43, 137, 182
MluCI AATT 1 cut(s) 162
MseI TTAA 2 cut(s) 45, 165
MspR9I CCNGG 1 cut(s) 115
Mva1269I GAATGC 1 cut(s) 104
MvaI CCWGG 1 cut(s) 115
PceI AGGCCT 1 cut(s) 26
PctI GAATGC 1 cut(s) 104
Pfl23II CGTACG 1 cut(s) 103
Psp6I CCWGG 1 cut(s) 113
PspGI CCWGG 1 cut(s) 113
PspLI CGTACG 1 cut(s) 103
RsaI GTAC 1 cut(s) 105
RsaNI GTAC 1 cut(s) 104
SaqAI TTAA 2 cut(s) 45, 165
ScrFI CCNGG 1 cut(s) 115
SetI ASST 1 cut(s) 56
SgeI CNNG 7 cut(s) 19, 31, 40, 51, 72, 126, 127
Sse9I AATT 1 cut(s) 162
SseBI AGGCCT 1 cut(s) 26
StuI AGGCCT 1 cut(s) 26
StyD4I CCNGG 1 cut(s) 113
TasI AATT 1 cut(s) 162
Tru1I TTAA 2 cut(s) 45, 165
Tru9I TTAA 2 cut(s) 45, 165
TspDTI ATGAA 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.